1 2 E. Donkey 8. Two independent genes are located near each other on the genome of the mouse. Whiskers is required for formation of whiskers, fur is required for fur formation, assume mutations in these genes are recessive (ie require a homozygous to be no-fur, no whiskers)
Q: V. Pathologic simple columnar epithelium - Celiac Disease V. Pathologic pseudostratified columnar…
A: Celiac disease is a chronic autoimmune disease charactirized by an immune triggred ebteropathy upon…
Q: describe arguments for and against classifying feathers as an adaptation to flying in birds.
A: Adaptation:the act or process of changing to better suit a situation. a body part or feature or a…
Q: What makes Science different from other subjects?
A: Science can be defined as the pursuit of knowledge and understanding of the social and natural…
Q: What are the characteristics of Paramecium sp. from your hay infusion culture.
A: Paramecium is genus of eukaryotic and unicellular in organism. They are commonly found in…
Q: What are building blocks of a nucleic acid?
A: Since you have asked a question with multiple parts, we will solve the first three questions for…
Q: o you a rare male calico cat. Which statements are false? re because it likely has more than two sex…
A: Calico cat Male calico cats are the rare cat about 1 in 1000. They have both pattern on there skin…
Q: Draw the following epithelial tissues below and specify which part of the human body can it be…
A: The cell is the smallest unit of an organism capable of functioning independently. All living…
Q: When brown iodine is exposed to starch it turns dark purple. In an experiment, you placed water and…
A: Membrane transport mechanism is a phenomenon which tells how molecules are transported across the…
Q: Part II: Determine the type of inheritance: For each of the following examples, determine the most…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Was the entire NFAT3 protein in the prey vector that gave a positive rest it only a region of the…
A: The yeast two-hybrid technique is designed to find protein-protein interactions. The yeast…
Q: (a) 2) On the figure below label the figure & describe each step for a photoreceptor in the DARK 11…
A: Rods are the name given to the night vision photoreceptors. Although rods are proven to saturate in…
Q: Which statement is correct? a. The hard palate is anterior to the soft palate b. The hard palate…
A:
Q: Chronically shortened muscles will lose sarcomeres in series in order to maintain ideal amounts of…
A: Skeletal muscles contain connective tissue, blood vessels, and nerves. There are three layers of…
Q: Which of the following facts are the most dangerous to the human body when present in excess…
A: Trans fatty acid has the two hydrogen atoms on opposite sides.
Q: Which of the following are characteristics of animal cells? Select the correct response(s): Their…
A: Eukaryotic cell is a more advanced type of cell which contain true nucleus and membrane bound…
Q: Question 22 of 25 Which of the following are descriptive of the eukaryotic DNA? Select the correct…
A: Eukaryuotic cell contajns eukaryotic DNA in its nucleus. The Eukaryotic cell is much developed in…
Q: Suppose that a bird's metabolic rate while flying at 30 km/h is 8 kJ/h. What is the bird's cost of…
A: Introduction The collection of chemical processes in organisms that maintain life is known as…
Q: Suborder Superfamily Family Subfamily Tribe Subtribe Ganodermataceae Poaceae Oryzoideae Oryzeae…
A: While classifying any organisms, the taxonomic rank system is followed where in the organism is…
Q: Please rewrite the objectives below as SMART objectives Help cancer patients feel better when they…
A: The given question is asked to rewrite the objectives in a more convenient way. We have to assume…
Q: Among the given statements, which ones describe the lysosomes? Select the correct response(s): They…
A: Lysosomes are membrane enclosed organelles that cintain an array of enzymes capable of breakdown all…
Q: What is the chemical formula that living things can use? ONO2 ΟΝ O N2 NO3
A: Nitrogen is essential for the growth and advancement of all living organisms. The environmental air…
Q: If blood pressure was to drop, how is the signal transmitted to the central nervous system? a)…
A: Introduction Blood pressure is the pressure of blood pushing against the walls of our arteries. Our…
Q: 2N=4 A B C D A B C D 0000 1000 Oooo 000 A hypothetical animal species has 4 chromosomes in each…
A: Cell division is a phenomenon in which parent cell undergo splitting process and give rise to novel…
Q: Automating Digital Pathology Image Analysis With Machine Learning on Databricks
A: Introduction - Image analysis techniques generally fall in the realm of traditional (hand crafted)…
Q: Among the given statements, which are characteristics of plant cells? Select the correct…
A: Plant cells These cells are eukaryotic cells that have a true nucleus and other specialized…
Q: Explain the relationship between island size, distance from the mainland, and biodiversity
A:
Q: the physician has ordered amoxicillin 20mg/kg PO BID . the patient weighs 98lbs . amoxicillin is…
A: Desired dose:- that amount of dose which is to be administered dosage ordered:- that total amount of…
Q: e to profound sensorineural hearing loss, with normal middle ear functioning. Hearing aid trials…
A: cochlear implantation after bacterial meningitis in very young infants. cochlear implants before…
Q: 4. What effects does norepinephrine (NE) secreted by the sympathetic division and epinephrine (EPI)…
A: 4.ans) Norepinephrine is indicated for blodd pressure control in certain acute hypotensive states.…
Q: How does the blood moves from the body and the heart and what is the circulation of the blood? Write…
A: Introduction :- The heart has two atria and two ventricles, making up its four chambers. Blood with…
Q: To make 200 ml 0.4XSSC (Saline and Sodium Citrate) solution for FISH post-washing, how many ml 20X…
A: FISH is defined as Fluorescence InSitu Hybridization. In this technique Fluorescence probe is used.
Q: Draw the following epithelial tissues below and specify which part of the human body can it be…
A: Celiac disease is a chronic autoimmune disease charactirized by an immune triggred ebteropathy upon…
Q: What are three methods used to classify infectious diseases and give two examples of each.
A: An infectious disease can be defined as an illness due to a pathogen or its toxic product, which…
Q: Eukaryotic ribosomes (choose all that apply) i Multiple answers: Multiple answers are accepted for…
A: Ribosome- The main organelle of translation is ribosome, which is very important in protein…
Q: Initial Data for Mardi Gras Virus Experiment Observation Physical nature of the virion Electron…
A: (a) The effect of ether on MGV virus is given in the physical nature of the virion. It states that…
Q: Where are the baroreceptors that monitor blood pressure located? a) aorta and subclavian arteries…
A: The blood volume and blood pressure are need to regulate very critically because it will directly…
Q: The formula given in the textbook for Q10 is RT/R(T-10), where R = metabolic rate and T temperature.…
A: A. Here we can use the basic equation, since the change is 10 degree celsius Q10= 2.2 / 1 = 2.2
Q: Ascorbic acid or vitamin C is involved in major functions of the body and also promotes the…
A: Vitamins Vitamins are the micronutrients present in the food we eat. They are required in many…
Q: 1) New nucleic acids are made 5' to 3'! 2) Base paired strands are antiparallel. Apply this…
A: One of the two DNA strands present at the replication fork, known as the leading strand, replicates…
Q: 12. In the phylogeny below, circle the following: (Label "A") The least inclusive clade that…
A: Clade A branch that includes single common ancestor and all of it's descendants.
Q: Describe the intracellular, biochemical downstream signal cascade that results from the binding of…
A: The somatosensory system uses transient receptor potential melastatin 8 (TRPM8) channels to detect…
Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…
A: An organelle of a cell which is membrane-bound and houses digestive enzymes is called a lysosome.…
Q: 7. Water always moves from a hyposmotic/hyperosmotic to a hyposmotic/hyperosmotic (circle or…
A: Introduction : The magnificent network of transportation networks found in living things is…
Q: What are homeostatic mechanisms aimed at maintaining? Select one: O a. Life baby, Life !!!!!!!!!! O…
A: A living organism has several different biochemical processes going on within their body. Every…
Q: 1. The body-cover trait displays an extranuclear maternal inheritance pattern. The alleles for this…
A: Extrachromosomal genes, besides DNA-encoded genes, can be found in organelles besides the nucleus,…
Q: 2. A zebra weighing 78 kg was crossed with a zebra weighing 55 kg, and the offspring produced was 62…
A: The genetic material from the parents is passed on to the kids. Mendelian inheritance refers to…
Q: The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers…
A: OCTN is a small subfamily of membrane transport proteins that belongs to the larger SLC22 family.…
Q: The bicoid gene in drosophila presents maternal effects and determines the body structure of…
A: Maternal effect is a phenomenon in which the genes present in the mother's nucleus influences the…
Q: sperm
A: The condition in which the PSA test is normal but the number of sperms are less is called a false…
Q: In the study of human nature, what is the meaning of the acronym WEIRD? People who are Western,…
A: The study of human behaviour in psychology includes the physical, mental and emotional perspectives…
D e f g
Step by step
Solved in 2 steps
- 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a prokaryotic chromosome/genome. 5. Compare/contrast 4 differences between Eukaryotic and Prokaryotic GENE structure & gene EXPRESSION (including regulatory sequences).GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…GTTTTCACTGGCGAGCGTCATCTTCCTACT 7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog). 10. Generate a secondary structure prediction for one identified protein.
- Biol 1406-Lec 17 - Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Question completion Status. Blackboard Learn Which of the following stater X 9. Which of the following statements about transcription is not true? In both prokaryotes and eukaryotes, pre-mRNA is modified after transcription by adding a 5' cap and a 3' poly-A tail and splicing out introns leaving coding exons. Paraphrasing Tool - QuillBot Your disk is almos Save space by optir O During transcription only one DNA strand called the template strand is read and rewritten by RNA polymerase with the template strand read in the 3' to 5' direction and the mRNA transcript synthesized in the 5' to 3' direction. O During initiation of transcription, RNA polymerase binds to the promoter region in the DNA, unwinds the DNA and binds together RNA nucleotides complementary to the template DNA strand. O During initiation of eukaryotic transcription, the promoter region contains a TATA box in which transcription…1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >Instructions: Here is some information about the sequences: All these sequences, “SEQUENCE_21” to “SEQUENCE_27” are in the same subfamily or “clade” of a large phylogenetic alignment of all Rab proteins in these three species (see “Figure 1.pdf”,which is the second image, for a full view of gene family in humans, plants and yeast, see the “D” branch towards the bottom of the tree in Figure 1). “SEQUENCE_28” is a different Rab protein (actually it is the Rab39 protein at the bottom of the tree). “SEQUENCE_21” is from yeast. “SEQUENCE_22” to “SEQUENCE_25” are from the plant, Arabidopsis. “SEQUENCE_26” and “SEQUENCE_27” are from humans. Question: Based on the information above, what can you speculate about the possible evolution of the genes that “SEQUENCE_21” to “SEQUENCE_27” represent?
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the results for r
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA8. Two independent genes are located near each other on the genome of the mouse. Whiskers is required for formation of whiskers, fur is required for fur formation, assume mutations in these genes are recessive (le require a homozygous to be no-fur, no whiskers) Non-coding region Non-coding region Non-coding region whiskers F fur A B D E F a) If you insert an extra nucleotide at position B, what will be the phenotype of an animal homozygous for this mutation? (circle one for each: Fur/no fur whiskers/no whiskers ) b) If you insert a nucleotide at position C, what will be the homozygous phenotype? (circle one for each: Fur/no fur whiskers/no whiskers ) c) If you insert a nucleotide at position E, what will be the homozygous phenotype? (circle one for each: Fur/no fur whiskers/no whiskers) d) If you insert a nucleotide at position B, and take one away from position C, what will be the homozygous phenotype? (circle one for each: Fur/no fur whiskers/no whiskers) e) If you insert a…