1 a- What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs? b- Nucleic acid structure Describe briefly what is meant by saying that two DNA strands are complementary. c- Identify DNA structural and functional elements from the nucleotide sequence information. Listed below are five DNA sequences. Which one contains a type-II restriction endonuclease (6 cutter) hexanucleotide site? Which one is likely to form a cruciform structure (draw the structure)? Which one is likely to be found in the Z-DNA form? Which one represents the 5' end of a tRNA gene? Which one is most likely to be in the triplex form? a. CGCGCGCCGCGCACGCGCTCGCGCGCC GC b. GAACGTCGTATTTCCCGTTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCG

1 a- What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs? b- Nucleic acid structure Describe briefly what is meant by saying that two DNA strands are complementary. c- Identify DNA structural and functional elements from the nucleotide sequence information. Listed below are five DNA sequences. Which one contains a type-II restriction endonuclease (6 cutter) hexanucleotide site? Which one is likely to form a cruciform structure (draw the structure)? Which one is likely to be found in the Z-DNA form? Which one represents the 5' end of a tRNA gene? Which one is most likely to be in the triplex form? a. CGCGCGCCGCGCACGCGCTCGCGCGCC GC b. GAACGTCGTATTTCCCGTTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCG

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

7 a-d. i. ii. Draw the following base pair arrangements in B-DNA if you were looking down the barrel of the helix. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in these bonds as hydrogen bond donors with a D and hydrogen bond acceptors with an A. Draw a thicker line leaving the atoms that participate in the glycosidic bonds. iii. iv. Label the major and minor groove on the common pairings, shown in "a" and "c". a. Adenine-Thymine Base Pair b. Adenine (rare form)- Cytosine c. Guanine-Cytosine Base Pair d. Guanine (rare form) - Thymine 7e. On your picture in question "a", highlight or circle the proton that shifts when Adenine tautomerizes to its rare imino form. Draw an arrow pointing to the atom it moves to. 7f. On your picture in question "c", highlight or circle the proton that shifts when Guanine tautomerizes to its rare enol form. Draw an arrow pointing to the atom it moves to.
Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG
A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers aredashed orange lines. Which Okazaki fragment was made first? When ligase joins fragments Aand B, will it act at arrow 1, arrow 2, or both?
DNA Polymerase Holoenzyme Ill is represented below. It consists of several domains with distinct functions. The structure that provides high processivity (processivity factor) is represented by the letter and the structure that provides DNA proofreading function is represented by the letter A В. -C -D DNA Pol III holoenzyme В; D А; А А; D D; A A; C
5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluorescent label. *5'------3'-0H 3'------ATTACGCAAGGACATTAGAC---5' A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. Lane 1: DATP, dTTP, dCTP, dGTP, ddTTP Lane 2: DATP, dTTP, dCTP, dGTP, ddCTP Lane 3: DATP, DTTP, dCTP, dGTP, ddATP Lane 4: DATP, dTTP, DCTP, dGTP, ddGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes on the gel look like? ( Fill in the gel below.) 3 Electrophoresis Il||
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in
Biochemist Erwin Chargaff was the first to discover that, in DNA, [A] = [T] and [G] = [C]. These equalities are now known as Chargaff's rule. Using Chargaff's rule, determine the percentages of all of the bases in DNA that is 26% thymine. Adenine = 22 Incorrect Cytosine = 28 Incorrect Guanine = 28 Incorrect PrtSc Insert Delete F11 F12 Backsp 8. 9. K M
a) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…