1. DNA is used to tell people apart. What aspects of DNA do you think make this possible? 2. What are some possible uses for technology that can identify people based on their DNA?
Q: The Human Genome Project was created in 1990 as an international effort began to analyze the human…
A: The Human Genome Project was an international scientific research project with the aim to determine…
Q: (20)Genetic engineering utilized to create food sources has been said to be both like and unlike…
A: Genetic engineering is a biotechnological application that enables the development of genetically…
Q: 1) What do you want to learn, if anything, about your own genome? Answer: Honestly i am not a…
A: The trillions of cells in a human organization, based on particular structural and functional…
Q: What percentage of our DNA do you think is the same in all humans
A: The genome is the genetic material of a living organism. It is the set of coded instructions that…
Q: 1. What does DNA stand for? 1 2. What model represents
A: DNA, short for deoxyribonucleic acid, is the molecule that contains the genetic code of organisms.…
Q: 1. What are ethical issues related with GMOS? Do you think human cloning should be allowed or should…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: How has DNA technology advanced the reconstruction of one-living and currently-living organisms? B.…
A: We have known that an organism's DNA affects how it looks, how it behaves, and its physiology. So a…
Q: what is your opinion on Genetic Engineering? Support your opinion with facts and include the issue…
A: Genetic engineering: Genetic engineering is the process of altering an organism's genetic makeup…
Q: We all carry about 20,000 genes in our genome. So far, patents have been issued for more than 6000…
A: A type of intellectual property that gives the inventor an exclusive right for his/her invention is…
Q: 2. How have new technologies, such as DNA analysis and biochemical tests changed the way organisms…
A: Given: The hierarchy of classification suffers from its own disadvantages when only the physical…
Q: 1. How are bacteria used in genetic engineering to produce medicine for people? 2. How is…
A: Answer : as we know bacteria is an independent living organisms and contains the genetic material.…
Q: Genetics on our daily lives, make an essay on how Genetics is affecting our lives by discussing at…
A: INTRODUCTION Genetic is mainly study for the genes and hereditary activities and to…
Q: Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical…
A: In the United States, radiation absorbed dose, effective dose, and exposure are sometimes measured…
Q: 12. The smallest unit of genetic material which produces a phenotypic effect on mutation is A. Muton…
A: 12= Muton is the smallest unit of genetic material which produces a phenotypic effect on mutation.…
Q: 2. How different would your DNA be if you had an identical twin? 3. Imagine that you are a forensic…
A: Identical twins are also known as monozygotic twins. They result from the fertilization of a single…
Q: What do you think the risks and benefits are of genetic testing?
A: Genetic testing involves the study and analyzing the changes in DNA ;Chromosome structure and gene…
Q: Would it be better to have your DNA sequences and find out about your genetic health? 2. What if the…
A: The technique of detecting the genomic DNA sequence, or the sequence of nucleotides in DNA, is known…
Q: Is it wrong to undergo genetic enhancements? Why or why not? Support your answer.
A: The introduction of modifications into a genome or epigenome with the aim of modifying and improving…
Q: ow could learning about genetic engineering help scientists to mass produce proteins and other…
A: Genetic engineering or recombinant DNA technology refers to the modification in an organism's DNA to…
Q: DNA technology has many medical applications. Which of the following is not done routinely at…
A: Ever since DNA was discovered as the primary genetic molecule in living organisms, numerous attempts…
Q: I am curious to learn more about genetic testing. How can I be tested to know whether I am…
A: The benefit of genetic testing is that, If an individual receive a positive outcome, a person can…
Q: 1. Which is a potential ethical issue resulting from the use of biotechnology? deteriorating the…
A: Human beings utilize the resources of their environment for their benefit. Often there are direct or…
Q: Imagine you've been offered a deal from a genomics company. You can get a free genome sequence – an…
A: Yes. I'll be interested. I feel this is the future. Genetic testing / Gene profiling. Currently,…
Q: 2. Can you develop a molecular biology assay to help forensic scientist to identify the criminal…
A: Forensic science is the application of science used to identify crimes and investigate with the help…
Q: Describe the experiments done by Hershey and Chase That Verified That DNA was the genetic material.…
A: Introduction: Researchers determined that the element responsible for the transmission of features…
Q: 1. Do you think the Food and Drug Administration should or should not approve gene therapy…
A: we are answering question 1 only pls repost for rest of question.
Q: genetically modified organism
A: Genetically modified organism or GMO: These are the organisms with superior characters made with…
Q: What are some ways that recent DNA technologies might affect you personally?
A: These days, DNA-based technology is very common. Biotechnology is the process of manipulating living…
Q: 1. When you simply look at the banding patterns on the gel from the DNA fingerprint we ran in lab as…
A: Gel electrophoresis is a molecular biology technique that is used commonly after DNA isolation to…
Q: 7) The Human Genome project cost billions of dollars to complete. What was it and do you think it…
A: For long, many people thought of the Human Genome Project as biology's "moon shot." The United…
Q: Do you thin genetically modified fish is good? What is your opinion about it?
A: -Jawless fish, cartilaginous fish, and bony fish that have had their genetic material (DNA) altered…
Q: The direct manipulation of genes is called O genetic engineering O DNA sequencing nucleic acid…
A: Gene can be defined as a unit of heredity.It is a segment of DNA(nucleotide sequence)that may…
Q: How are scientists able to realize their objectives in genetic engineerin
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What are the various forms of gene therapy and how are they done?
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: What is DNA and what do it look like? 2. Does the DNA of human Body could fit in a plate? 3. Where…
A: In every animal, the genetic material is carried out by a chromosome or any other structure that…
Q: How is genetic engineering done? 2. What are 3 foods sold in supermarkets that have been…
A: Hello! Since you have asked multiple questions, we will solve the first question for you. If you…
Q: 4). A scientist analyzed a segment of 1 point DNA from a human chromosome and found that the…
A: The correct answer is (c) Row 3
Q: I want to genetically transform an entire organism. To accomplish this do you think it is easier to…
A: Genetic transformation is a process, which involves the introduction and expression of foreign…
Q: How do genetic technologies impact our society?
A: Several studies have been conducted on genetic engineering, with a particular emphasis on its…
Q: WHY DO WE NEED GENETIC ENGINEERING?
A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…
Q: (11) Genetic engineering utilized to create food sources has been said to be both like and unlike…
A: Genetic engineering is a set of molecular biology techniques that enable the scientists to…
Q: What is it? A description of your GENETIC technology (Make sure you are looking how genetic tech is…
A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…
Q: What genetically engineered products do you currently use or consume? Are they safe? Why or why not?
A: Genetically modified crops or GM crops exist for many species such as corn varieties, and soybeans.…
Q: 1. Why do you think discoveries in genetics have been recognized with so many Nobel Prizes?
A: *Genetics is the branch of biology concerned with the study of genes, genetic variation, and…
Q: Answer the following question briefly but intelligently. 1.) In your perspective, with the…
A: Genetic Engineering : It is the process of using recombinant DNA technology to alter the genetic…
Q: DNA fingerprinting uses restriction enzymes to identify a person or organism based on the pattern of…
A: Introduction "The method of DNA fingerprinting reveals the hereditary makeup of living organisms.…
Q: 1. How does selective breeding enable humans to create new varieties of plants and animals? 2. What…
A: WHAT IS SELECTIVE BREEDING ? It is an artificial selection process used to develop new organisms…
Q: 4. Why do you need to perform PCR on DNA evidence from a crime scene?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Forensic investigations: Compare the DNA collected from the crime scene to determine which of the…
A: DNA fingerprinting utilizes the unique DNA fingerprints present in the human genome. These are…
Q: 1. Do you think genetic engineering is a real solution? What about using genetics as a crime control…
A: Genetic engineering has proved to be a solution for many problems and has been highly useful in the…
DNA profiling
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- From your knowledge about DNA microarray, answer the following: Why RT-PCR is important in the sample preparation to perform expression microarray experiment?(DNA EXTRACTION Materials: knife 1 cup of fruit Table salt clean piece of cloth or strainer for filtering resealable bag dishwashing liquid 70% rubbing alcohol (chilled) shot glass (or any transparent and narrow container resembling a test tube) How to do the extraction: Before you begin, make sure you have chilled your alcohol in the freezer for at least 3 hours. Room temperature alcohol will not work nearly as well as cold alcohol. Place about 50 mL of alcohol in the freezer to chill it and take it out only when you’re going to need it. (The alcohol will not actually freeze.) 1. The first thing you will need is a sample. Since DNA is found in all living…DNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA fluoresces when illuminated with UV light the binding of a fluorescent dye that is easily detectable using radioactive antibodies that specifically bind to DNA the fact that DNA is blue and can be seen when millions of copies are present in a band
- Which of the following are necessary for Sanger sequencing? Select all correct answers. Group of answer choices ddNTPs an oligonucleotide primer DNA polymerase dNTPs DNA ligase a restriction enzymeGel Electrophoresis is used often in forensics. Look at the following gel to the left. From the evidence DNA, which individual matches the DNA evidence left at the crime scene?In a PCR-based crime scene investigation, similar to the one presented in the lab module with Brother Y and Brother X, there is a sample of DNA from a crime scene that is likely to belong to the guilty party. Based on the gel photo below, which shows the results of an electrophoresis gel following PCR amplification at one locus of 5 DNA samples - one crime scene sample and 4 suspects - which suspects can be excluded from this investigation? [Keep in mind that it is not possible for a heterozygous person to leave only one allele at a crime scene. If any one allele does not match, then that suspect is eliminated.] Choose all that apply.
- You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exact fragment sizes are not important.PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…PCR technique is based on DNA transcription. True False