1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA primary transcript sequence 5' GGG AUG UCA CAC AUA UUU 1 2 3 4 5 6
Q: Arrestin has a mutation that prevents it from binding the GPCR receptor in the PLC pathway. How…
A: Arrestins These are also referred as Arr. These are proteins that are involved in vital signal…
Q: A. Fill in the table by comparing the following biological molecules. Biological Molecules Basic…
A: Every living organisms have cells which is the smallest structure and functional unit of the…
Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…
A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…
Q: What suggestions would you give for improving one’s immune system? Please explain the reasoning…
A: Immune system is very important for the proper functioning of body, without immune system our organs…
Q: What happens if you ingest too much triacylglycerol?
A: Triglycerides are a type of fat (lipid) found in your blood. When you eat, your body converts any…
Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…
A: A Cell is made up different molecules that help it in maintaining its structure and function.…
Q: Why do anisogamous organisms only experience the twofold cost of sex?
A: Anisogamy is a type of sexual reproduction that involves the union or fusion of two gametes that…
Q: Below is a Figure of a Shoot Tip, Is the encircled part a permanent tissue? True or False
A: Permanent tissue Tissues that attained their mature form and perform Pacific functions. They stop…
Q: The following strand is a template strand: 3'-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is…
A: DNA ( Deoxyribonucleic acid) is ladder like helical structure which act as genetic material in most…
Q: 9. Most species of Clostridium, which are widely distributed in the environment, are harmless to…
A: Infection is the entrance of pathogens into an organism's bodily tissues, their growth, and the host…
Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…
A: Enzymes are the biological catalyst which increases the rate of reaction. The molecules upon which…
Q: Leech obtains continuous blood flow from its victim by pouring in it- (A) Heparin (B) Hirudin (C)…
A: Introduction - Leeches are parasitic or predatory worms with segmented bodies that belong to the…
Q: In chymotrypsin the active site histidine Forms a tetrahedral intermediate O a. O b. Acts as a…
A: Serine protease is part of the catalytic triad and consists of the serine, aspartic acid, and…
Q: Which of the following applies to quaternary structure? O a. It has two alpha and two beta subunits…
A: Introduction The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as…
Q: QUESTION 1 Picture 1 Pic. 1: Name one genus/species from the fungi we studied that might be growing…
A: Fungi are Eukaryotic organism that can be one cell or many celled . Fungi is classified into :- I…
Q: Which of the following is an evolutionary leftover from a feature that a common ancestral special…
A: Introduction Evolution:- It is a process of gradual change in the characteristics of a species over…
Q: There are tiHee SUUIcesUII down five (5) examples for each hazard. Human Factor Hazards Equipment…
A: A hazard is a source of potential damage, harm or adverse health effect on something or someone.…
Q: When there is light, plants release oxygen. What else may plants also use oxygen in? photosynthesis…
A: Plants release oxygen from photosynthesis. Photosynthesis is a process in which green plants prepare…
Q: Which of the following hormones is NOT correctly matched to the event? Group of answer choices…
A: Hormones are our body's chemical messengers. They travel in your bloodstream to tissues or organs.…
Q: ELEMENTS MACROMOLECULE FUNCTION MONOMER POLYMER EXAMPLE(S) CONTAINED CARBOHYDRATES LIPIDS
A: Carbohydrates supply energy to the body, which is one of their key purposes. Before reaching the…
Q: During which process of photosynthesis is water split and oxygen released? Calvin Cycle photosystem…
A: Photosynthesis is the process of conversion of CO2 and water molecule in sugars and oxygen.
Q: Which of the following is incorrect about the differences between DNA and RNA? O RNA uses the base…
A: DNA and RNA are the nucleic acid material because both are made up of nucleotides. These nucleic…
Q: Indicate whether each of the following conditions would increase or decrease the rate of…
A: Non carbohydrate substrates convert into glucose through gluconeogenesis process. When blood…
Q: Below is a Figure from a Shoot Tip, determine which labeled part is/are meristematic? 2
A: Apical meristem Region of cells capable of division and growth in the root and shoot tips in plants.…
Q: Which of the following is not part of a carpel? O anther O style O stigma O ovary
A: The central whorl of a flower is made up of leaflike, seed-bearing components. The pistil is made up…
Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?
A: The gene products of the lac operon are very important for lactose metabolism. This is crucial for…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…
A: Adenine, guanine, cytosine and thymine are the nucleotide bases of DNA that stores genetic…
Q: write a short reflection paragraph on the role of extracellular matrix on tumor progression.
A: Cancer results from the formation of tumors that have the ability to metastasize.
Q: 2. 3. What does the term symbiosis mean?
A: Introduction Ecology:- It is the study of the relationships between living organisms, including…
Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…
A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…
Q: In a study, melanoma patients who developed vitiligo, lived longer than those who did not. The…
A: Melanoma It is defined as the type of skin cancer in which melanocytes are affected and cause…
Q: Which of the following statements regarding nucleotides is false? A) Nucleotides contain sugar…
A: The nucleotide is the sub unit of nucleic acid. DNA and RNA are the examples of nucleic acid. The…
Q: To explain: The way in which the shortened telomeres affect the life-span of IPSCS and…
A: Stem cells are an undifferentiated mass of cells that can differentiate into specific cell types.…
Q: Describe evidence supporting the hypothesis that red algae and green algae should be included in a…
A: Monophyletic groups are the ones that include all the descendants of a common ancestor.
Q: In the beginning of the Surgery section, what is the “general” section? Do we use modifiers in the…
A: General surgery is a surgical speciality that focuses on abdominal contents such as the oesophagus,…
Q: What is Ponceau S and why do we use it during western blotting?
A:
Q: If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is…
A: We got the information of first type in carboxyl terminus of soluble ER proteins and in golgi…
Q: What do you mean by protandry? Give its advantages?
A: The term protandry comes from two Latin terms, Proto= First and andro= male (thus, anthers in case…
Q: How much does sickle cell anemia impact males, females or a particular ethnic group. How much of an…
A: Answer
Q: Biological Molecules– ModellingActivity AC1.1-lustrate or construct molecular models of simple…
A:
Q: PROTEINS NUCLEIC ACIDS
A: Proteins serve a variety of purposes, such functioning as enzymes and hormones, regulating fluid and…
Q: phylogenetic tree according the the island: 1) Anolis sheplani 2) Anolis cybotes 3) Anolis olssoni…
A: Phylogenetic tree A phylogenetic tree is an evolutionary tree that depicts the evolutionary…
Q: 6.3.7 Activity 6.1 2 List and briefly explain four methods of studying an E-S complex. ngenic…
A: Answer :- 1) There are various methods of studying the Enzyme-substrate complex like magnetic…
Q: Describe an example to demonstrate that even if a gene is known to produce an undesirable result, a…
A: Studies on environmental factors affecting the phenotype of an animal has shown multiple positive…
Q: Mitochondria produce which of the following? A. ATP B. DNA C. RNA D. proteins
A: Answer :- Option A correct, Mitochondria which is produce ATP (adenosine tri phosphate) ATP are…
Q: Describe the ethical issues encompassing germ line gene therapy in 150 words.
A: Introduction Germline gene therapy:- In this therapy DNA is inserted into the reproductive cells…
Q: How would DCMU affect formation of ATP? Of NADPH? Explain.
A: DCMU is a very specific and sensitive inhibitor of photosynthesis. It blocks the QB plastoquinone…
Q: Why are okazaki fragments necessary on the lagging strand?
A: In a long DNA molecule, since the the two strands of DNA cannot be separated in its entire length…
Q: The following pedigree shows the inheritance of a disease due to a completely penetrant sex-linked…
A: ANSWER;- A) The probability of the son indicated by the question mark will have the disease is 1/2…
Q: 6.3.7 Activity 6.1 (1) List and briefly explain four methods of studying an E-S complex. (2) (a)…
A: Introduction When an enzyme comes into complete contact with its substrate, a temporary molecule…
Step by step
Solved in 2 steps
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
- www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcriptionDirection: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino acid base on the DNA sequence provided per item. Determine the type of mutation and explain its effect on the expression of amino acids. 1. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT inim Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT ww mm Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids?Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'
- 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneBamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.