16. Which of the following describes what happens to the codons of a cell that is affected by sickle cell anemia? Codon GTG changes to GAG. The codon GAG, which codes for glutamic acid, changes to a stop codon. The mRNA codon contains two bases instead of three. A point mutation causes the amino acid valine to be formed, instead of the amino acid glutamic acid.

16. Which of the following describes what happens to the codons of a cell that is affected by sickle cell anemia? Codon GTG changes to GAG. The codon GAG, which codes for glutamic acid, changes to a stop codon. The mRNA codon contains two bases instead of three. A point mutation causes the amino acid valine to be formed, instead of the amino acid glutamic acid.

Name: Need correct answer 16. Which of the following describes what happens
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Need correct answer 16. Which of the following describes what happens to the codons of a cell that is affected by sickle cell anemia?Codon GTG changes to GAG.The codon GAG, which codes for glutamic acid, changes to a stop codon.The mRNA codon contain

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

How many nucleotides are in 12 mRNA codons? 12 24 36 43
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
15. The following is a list of some mRNA codons representing various amino acids. Met-AUG, Pro - CCC, Phe-UUU, Gly - GGC, GGU Leu - CUA, Arg - CGA, CGG Ser - UCU, Asp - AAU Thr-ACC, Val - GUA His - CAC A portion of a strand of DNA contains the following nucleotide sequence: 5'... AAA GAT TAC CAT GGG CCG GCT...3' (a) What is the mRNA sequence transcribed from it? (b) What is the amino acid sequence of this partially-synthesized protein? Cur or (c) What is the amino acid sequence if, during transcription, the third G on the left in the DNA is read as T? beri (d) What is the amino acid sequence if, during translation, the first two Us of the mRNA are not read and the fourth C from the left in the mRNA is not read or is deleted?
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
3. Below is part of the DNA genetic code for six amino acids. CGG GCG Codes for alanine Codes for arginine Codes for glycine Codes for lysine AAA Codes for phenylalanine Codes for valine TTT CCA САА The diagram below shows part of a mRNA molecule and the corresponding part of the protein formed. arginine – glycine – lysine – valine – alanine Identify which codon contains a single transcription error. A. The first codon. B. The second codon. C. The third codon. D. The forth codon. E. The fifth codon.