4.Consider a cell in metaphase compared to a cell in rest (not in the cell cycle leading to cell division). What properties of a metaphase cell might let you extract more DNA compared to the resting cell? Are there any that might make the extraction more difficult?

4.Consider a cell in metaphase compared to a cell in rest (not in the cell cycle leading to cell division). What properties of a metaphase cell might let you extract more DNA compared to the resting cell? Are there any that might make the extraction more difficult?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter10: Cell Division And Mitosis

Section: Chapter Questions

Problem 1ITD: Biologists have long been interested in the effects of radiation on cells. In one experiment,...

See similar textbooks

Related questions

Q: 2. a) In the diagram of DNA below (Figure 4), a DNA strandis unwinding and new strands of DNA are…

A: The unwinding of DNA helix takes place with the help of enzyme DNA helicase. Addition of nucleotides…

Q: Why is it important for mitosis to produce genetically identical daughter cells?

A: The cell division is responsible for the generation of daughter cells from the mother cell. Usually…

Q: 7. In BIOLOGY, why is it BAD to have a Keq 1? B. If Keg =<1, how does this work in a cell for %3D a…

A: INTRODUCTION A constant, characteristic for each chemical reaction; relates the specific…

Q: 3. Label the phases of the cell cycle

A: Actively dividing eukaryote cells go through a series of stages that are referred to as the cell…

Q: 5. The repeating of growth AND division that many eukaryotes go through is A. a checkpoint alled B.…

A: Cell cycle/division is a pivotal process in all living organisms and includes cell division,…

Q: 4) In cell A, what structure is labeled X? 5) Which cell is in the "in between" phase of mitosis? 6)…

A: Mitosis can be defined as a cell division in which one cell divides into two genetically identical…

Q: how DNA be replicated during Interphase. What enzymes might be involved in DNA replication?

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: . A defective white blood cell does not complete the process of DNA replication. Which of the…

A: In order for the replication of DNA to occur there is a definite sequence of cell cycle that has to…

Q: 4 What does chromatin look like (Hint: This is the form DNA is in BEFORE mitosis) 1 Show Your Work

A: During cell division, chromatin often exhibits changes in shape and compaction and the undergoes…

Q: 5. Define mitosis. Why do cells undergo mitosis? 6. Does DNA copy itself during mitosis? PLEASE…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: What cell organelle of the strawberry was broken when it was crushed? a. Vacuole b. Nucleus c. Cell…

A: You have asked multiple questions. I will answer the first question, as allowed by guidelines.…

Q: Which of the following describe the nuclear envelope? a. It is continuous with the endomembrane…

A: If you want any specific questions to be solved, then please specify the question number or only…

Q: 1.In which phase of the cell cycle are DNA mutations most likely to occur? A.S Phase B.G1 Phase…

A: Mutation - Mutation is defined as the sudden inheritable changes which occurs either in the…

Q: 20. The cell cycle has many checkpoints to ensure the cell is ready for division. Which of the…

A: Q20. The checkpoints in the cell cycle are required to make sure that the cell is ready to divide.…

Q: 6. Which best-described checkpoint? A. A site in the cytoplasm where proteins are inspected for…

A: Introduction It's critical that the daughter cells produced are identical to the parent cell.…

Q: 2. From the zygote, pluricellular organisms are formed by serial mitosis. Would this formation be…

A: Introduction: Zygote is defined as an eukaryotic cell formed by a fertilization event between two…

Q: 3. Which of the following is NOT TRUE with respect to the cell cycle?

A: Cell cycle is sequence of events that takes place in a cell for cell division. It is divided into…

Q: What are the 3 main stages of the cell cycle?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: . Explain what the cell is doing in each of the following stages of the cell cycle.a) G1, b) S, c)…

A: Cell is the basic structural, functional, and biological unit of all known organisms. The cell…

Q: 3. What might happen to a cell whose DNA is destroyed? What might happen to a cell whose DNA is…

A: Cell whose DNA is damaged- Every cell in our body's DNA is continually at risk of being damaged.…

Q: 6. The types of human cells shown below are different from one another, even though they all…

A: All cells in the body arise from a single cells called zygote . Zygote formed by fertilization of…

Q: 3. What is asymmetric cell why is this important durir

A: Cell division is a significant portion of the cell cycle. The cell maintains the growth and shape by…

Q: 4. which cells contain condensed and duplicated chromosomes, with sister chromatids attached? Pick…

A: Mitosis is a process of cell division , which divides one cell into two daughter cells. The phases…

Q: 5) The process by which a cell copies its DNA before it divides is called: A) DNA replication B)…

A: DNA replication happens in the (centrosome/core) of an eukaryotic cell. DNA is repeated during the…

Q: 11. One difference between cancer cells and normal cells is that cancer cells A) are unable to…

A: There are two types of cell division: meiosis and mitosis. Mitosis is the equational cell division,…

Q: What is mitosis? cytokinesis?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: List three different structures that are present in plant cells, but not in animal cells.

A: Animal cells are eukaryotic cells. It means they contain a true nucleus and a specialized structure…

Q: Why is the lysosome considered as the suicide bag of the cell?

A: The branch of science which deals with the study of cells is known as cytology. Cytology basically…

Q: 8) There is a photo below, where you can see dividing cells near the tip of an onion root under the…

A: Stage in cell division where spindle lines up the chromosomes at the middle of the cell. METAPHASE…

Q: 2. What will happen if one of the proteins for initiation of replication synthesized by the cell?…

A: DNA replication is the process that occurs in the S phase (synthetic phase) of the cell cycle. This…

Q: _1. In this type of cell division, the nucleus of the cell divides into two (2) nuclei with…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: . What is the main difference between prokaryotic and eukaryotic cells?

A: There are two types of cells eukaryotic cells and prokaryotic cells, the cells differ in their…

Q: 1. Examine the micrographs provided on the following two pages, and find one good example of a plant…

A: Hi! Thank you for the question. As micrographs are only provided for the plant cells, I will be…

Q: 2. Compare and contrast the cells of plants versus the cells of mammals. How are they similar? How…

A: Plant cells are eukaryotic cells present in green plants, photosynthetic eukaryotes of the kingdom…

Q: 5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine…

A: In case of eukaryotic organism, cell containing nucleus, the cell cycle is categorized into two two…

Q: 10. The nuclei of a skin cell found in a gorilla contains 48 chromosomes. How many chromosomes would…

A: A chromosome is a long DNA molecule that contains part or all of an organism's genetic material.…

Q: 1) The activity of the cell cycle is controlled by the abundance of: A) protein ligases and…

A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…

Q: What did the virus conclude? , Which virus was used? , How did the virus help in the conclusion?…

A: A virus is a submicroscopic infectious agent that replicates only inside the living cells of an…

Q: 4. Why are the google images of cells different colors? What is the natural color of a cheek cell?

A: as per the guidlines we are supposed to answer only first question, please repost the other question…

Q: 2. When the enzyme telomerase was discovered, some termed it the "foundation of youth", as it is…

A: Telomerase are the enzymes also known as telomere terminal transferase is the enzyme made of protein…

Q: 1. What is a nucleosome? Briefly discuss its significance? 2. In what stage of interphase does…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is present in the…

Q: 4. Which statement about telomeres is incorrect? A) Telomeres are repetitive nucleotide sequences at…

A: A telomere constitutes end of a chromosome. Telomeres are made of repetitive sequence of non-coding…

Q: 4. Why can't plant cells divide their cytoplasm using cleavage? What form of cytokinesis do plant…

A: As you have asked multiple questions we are instructed to answer only one. Please repost the…

Q: Describe the levels of organization in the DNA molecule when in the form of a visible chromosome.…

A: Nucleosome model is a scientific model which explain the organization of the DNA and the associated…

Q: 2.) One experimental tool used in the biological research and in clinical settings is called…

A: FACS/ Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry, which…

Q: 2. If an N= 3 cell undergoes mitosis, what will be the number and structure of the chromosomes the…

A: In mitotic cell division a cell duplicates all of its contents, including its chromosomes, and…

Question

question 4 please

3.Write the role of each of the following substances in the DNA extraction
(Hint: page 98 of the lab manual or the virtual lab will be helpful):
a. Alcohol
b. Centrifugation
c. Detergent
4.Consider a cell in metaphase compared to a cell in rest (not in the cell
cycle leading to cell division). What properties of a metaphase cell might let
you extract more DNA compared to the resting cell? Are there any that
might make the extraction more difficult?
5.Describe the role of cell division in at least one of the following areas of
biology:
a. Stem cell research
b. Cell cloning for organ replacement therapies
c. Cancer (see the DNA LC's video on tumor growth for a
hint: https://dnalc.cshl.edu/resources/3d/31-tumor-
growth.html)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

3. The chemotherapeutic agent, paclitaxel, stabilizes microtubules (proteins that are part of the cytoskeleton) which are shown in green below. Chemotherapeutic agents are meant to kill rapidly dividing cells. A. Why is confocal microscopy an appropriate tool to study the role of paclitaxel on the cytoskeleton and the cell cycle more generally? B. Why would paclitaxel be harmful to a cell? Draw a cell that has been treated with paclitaxel during cell division. C. On the next page is a figure of microtubule length over time during multiple cell cycles. Analyze the effect of paclitaxel as compared to control. Why does this data show paclitaxel can be an effective chemotherapeutic agent?
1. The production of arginine is terminated by the presence of excess arginine. State which phenomenon is responsible for this outcome. Explain the phenomenon in brief. 2. Suppose, a group of scientists developed a recombinant enzyme having mutations in its active site. Do you think, the activity of an enzyme would differ from the wild type? 3. Which part of the cell has a model structure of a fluid mosaic? Why do you think this happens?
10. What are the different structural organizations during packaging of DNA in a eukaryofic cell? What is meant by denaturation of DNA? Define hyperchromicity of denaturation? What are extracellular matrix proteins? List their functions. How has fluorescence microscopy contributed to one understanding of the nature of cytoskeleton? a. Nanoparticles and their applications b. Molecular chaperones What are heterotrimeric and monomeric G-proteins? Discuss their functions. Describe the effect of the following molecules on electron transport chain. a. Thermogenin b. Oligomycin c. Atractyloside d. BAL a. Briefly discuss Ramchandran plot. b. What is quaternary structure of proteins? Mention the role of various bond in its structure with the help of an example give its biochemical function. ‘What are liposomes? Discuss their role in medicine. . Differentiate between cerebroside and ganglioside and one disorder associated with each. o SRS
4) Describe in detail how p53 and MDM2 regulate cell division in a normal, healthy cell. You should describe 1) how these proteins cooperate to allow a cell to go through the cell cycle, 2) how they cooperate to stop the cell cycle, and 3) how they allow the cell cycle to continue again after having stopped it initially. You may use point form if you want.
7. Complete the following for a cell that contains 6 chromosomes in early interphase (before replication occurs) Remember in early interphase each chromosomes exists as a simple chromatin strand, which replicates (doubles) just before prophase.
5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine will be covalently incorporated into the cell's DNA during replication. The radioactive DNA can be detected in the nuclei of individual cells by autoradiography (i.e.. by placing a photographic film over the cells, radioactive cells will activate the film and show up as black dots when looked at under a microscope). During whatphase of the cell cycle will the radioactive thymidine be incorporated? Why?
11. What could you add to an in vitro polymerization reaction of actin that would eliminate the initial slow phase of the curve below? 00% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Time % filaments
4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an example how it occurs and state the enzyme involved? 5. What is the difference between plasma membrane and cell wall?
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
Biologists have long been interested in the effects of radiation on cells. In one experiment, researchers examined the effect of radium on mitosis of chick embryo cells growing in culture. A population of experimental cells was examined under the microscope for the number of cells in telophase (as a measure of mitosis occurring) before, during, and after exposure to radium. The results are shown in the Figure. What is the effect of radium exposure on mitosis? Source: R. G. Canti and M. Donaldson. 1926. The effect of radium on mitosis in vitro. Proceedings of the Royal Society of London, Series B, Containing Papers of a Biological Character 100:413419.
6. Consider the process of transduction. Describe the process in terms of the cell that donates the genetic material and the cell that receives it. For full credit, include and define any key vocabulary words needed to understand the process.
Give typing answer with explanation and conclusion 1.) Define the following terms: Centrosome – A centrosome is Centromere – A centromere is Chromatid – A chromatid is Centriole – A centriole is Cell Cycle – A cell cycle is Checkpoint – A checkpoint is