5. Suppose that you made a mistake when you set up the thermocycler program and omitted the first 2 minutes at 95°C. How would this impact your PCR? 5. Suppose that you made a mistake when you set up the thermocycler program and only programmed for 10 cycles instead of 30 cycles. How would this impact your PCR?
Q: Describe the relationship between telomeres and senescence.
A: Chromosomes are the linear structures present during cell division.
Q: Which of the following scientific names is not correctly formatted? a)Helicobacter Pylori b)All of ...
A: ANSWER correct answer = Gorilla gorilla Kingdom: Animalia Phylum: Chordata Class: Mammalia ...
Q: Can you tell IF the pasteurization process is working in this milk producing plant? How can you expl...
A: Pasteurization is a process in which milk or milk product is heated to a certain temperature for a c...
Q: Which structure is highlighted? Multiple Choice saphenous nerve obturator nerve sciatic nerve and br...
A: Introduction Saphenous nerve:- it is the largest branch of the femoral nerve and innervates the medi...
Q: A collection of similar genera * a. family b. order c. kingdom d. genus
A: Classification means categorising something into groups on the basis of certain characters. Classifi...
Q: Did Soap Operas Reduce Fertility in Brazil?
A: In Brazil, there were no strict rules for a population control policy by the government, and it is i...
Q: 18. The figures below illustrate the similarities between ATP synthesis in mitochondria and chloropl...
A: ATP (adenosine triphosphate) comes under the category of energy molecule present in the human body t...
Q: In your own words, Explain how can the Subject Personal Identification of Fingerprinting benefiting ...
A: Introduction: The technique which is used to identify and analyze the variation on the basis of vari...
Q: Which of the following are produced in the light-dependent reactions? (Check all that apply.) Select...
A: The light-dependent phase is the first stage of photosynthesis, during which light energy (photon) i...
Q: According to Frans de Waal, the two main pillars of morality are Group of answer choices A: Cooperat...
A: Frans d waal is biologist and primatologist, he is known for his study on behavior and intelligence ...
Q: Describe norm of reaction and give an example.
A: The norm of reaction is a curve. It describes a a phenotypic pattern of a gene which varies in a dif...
Q: Match each term with the best description. ___ DNA replication a. basis of variation ...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: What are the differences of dogs from other kingdoms?
A: Identification : Whittaker proposes 5 kingdom classification based upon cell structure, organizati...
Q: What electron-transport components participate in the Q cycle in mitochondria, in purple bacteria, a...
A: The electron transport chain is also called the Cytochrome oxidase system or as the Respiratory chai...
Q: normal microbiota
A: Microbiota can refer to all the microorganisms found in an environment, including Bacteria, viruses...
Q: With over 369,000 species of angiosperms alone, why do you think we get most of our nourishment from...
A: Angiosperms are plants that produce flowers and bear their seeds in fruits. They are the largest and...
Q: 8. The process of arranging organisms into similar or related groups, primarily to make it easier to...
A: Classification is the process in which the organisms are arranged into similar or related groups
Q: Chimpanzees, bonobos, and orangutans cannot speak like us because Group of answer choices A: They ar...
A: ANSWER;- D) They are incapable of processing information and producing meaningful language
Q: Biologists assign each organism on Earth to a species containing similar organisms. Related species...
A: Classification is the process to arrange and categorizing organisms into group which is based on rel...
Q: You are a cat breeder and was asked to choose two parents (male and female) among a group of cats wi...
A: A genetic cross is the intentional mating of two people that results in the combination of genetic m...
Q: List and explain at least 3 Bacterial infections of the skin
A: EXPLANATIONBacterial skin infection: Bacterial skin infections form when bacteria enter through hair...
Q: This molecule: •contains potential energy •is used to convert CO2 into glucose •has an unstable trip...
A: The molecule is ATP and it has unstable triphosphate tail , the main energy sources comes from hydro...
Q: Dinosaurs like edmontosaur how do they defend themselves from predators like trex? Trex has most pow...
A: Paleontology is the study about fossils and it grouped the living things present at that time and th...
Q: C. Draw and place arrows that correspond to the structures of a liver cell or һеpatocyte. Cell Membr...
A: Liver: The liver monitors blood from the digestive organs, processes nutrients, eliminates toxins, p...
Q: When a cell reproduces by mitosis and cytoplasmic division, does its life end?
A: Mitosis is a process that results in the formation of two daughter cells that are identical in natur...
Q: Which of the following are differences between prokaryotic DNA replication and eukaryotic DNA replic...
A: Replication is the process of producing two daughter identical copies of DNA from one original paren...
Q: Give the functions of the following bacterial structures. Granules Pili Flagella Endospores Capsule
A: Bacteria is a prokaryotic cell which has many organelles to facilitate different functions.
Q: Homologous chromosomes_____ . a. are inherited from two parents b. are sister chromatids c. are diff...
A: Chromosomes are the structures that become visible during cell division only.
Q: How does the translated mRNA convert into a functional protein?
A: Translation is a process in which cells make the proteins.
Q: A “calico” cat (left) is mainly white with patches of black and orange fur. a. Almost all calico cat...
A: Introduction: Chromosomes are the condensed form of chromatin present in the nucleus of the cells. T...
Q: Control over eukaryotic gene expression drives______ . a. transcription factors c. embryonic develop...
A: In eukaryotes, gene expression is influenced by a wide range of mechanisms such as loss of genes, am...
Q: Describe and compare cytokinesis in animal and plant cells
A: Cytokinesis is the process by which the cytoplasm of the cell divides after the M phase.
Q: are my answers correct?? there were blank spaces
A: The DNA consists of 4 nitrogen bases which are Adenine (A), Thymine (T), Guanine (G), and Cytosine (...
Q: Why is the mechanism of ATP synthesis shared among both prokaryotic organisms and eukaryotic organel...
A: Adenosine triphosphate (ATP) is the energy-carrying molecule found in the cells of all living things...
Q: The greatest trophic diversity is found in which group of organisms?
A: Trophic means the hierarchical strata of a food web or nutrition. Trophic diversity means nutritiona...
Q: A biological treatment plant (CSTR) is being operated with ga waste consisting primarily of substrat...
A: In Biological treatment plants widely prescribed and applied plans the CSTR ( Continuous stirred-tan...
Q: Herpes Simplex Virus 1
A: Herpes simplex virus is a common virus that causes infections of the skin and mucous membranes. It c...
Q: 3. The presented sequences are coming from one ancestral sequence. Through RE, the ancestral sequenc...
A: DNA sequencing is a laboratory technique used to determine the exact sequence of bases (A, C, G, and...
Q: Mechanisms that govern gene expression do not operate during______ . a. transcription c. translation...
A: Gene expression is a process in which a gene is expressed into a gene product. A gene is a piece of ...
Q: An organism that harvested energy from electricity and got carbon to build biomolecules by harvestin...
A: In the ecosystem different organisms interact with each other. In the ecosystem a food web is observ...
Q: What is pharmacogenomics, and the role it plays on fast and slow etabolism and how it affects the to...
A: Pharmacogenomics is an approach to the advanced medical science which states or aims to define a pro...
Q: Question 314 Brain-heart infusion broth (BHIB) would best be described as: a) a selective medium O b...
A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid solution used to p...
Q: MATCH EACH WITH THE LETTER. 1. RIBOSOME 2. NUCLEUS 3. ROUGH ENDOPLASMIC RECTICULUM (ER) 4. SMOOT...
A: Matching of cell organelles with their functions :-
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: *morphology of Escherichia coli is identified as rough or a smooth form. *The trough forms colonies...
Q: How you think the needs of societies in the past differ from what we need today. How can the differ...
A: Society is getting changed at a fast speed nowadays. Some changes in society are acceptable. while s...
Q: Proteins can be separated into 9 general classifications based on the role they play in a cell. List...
A: Proteins can be classified into following types:- Fibrous Proteins Globular Proteins Derived Protei...
Q: The drug butenamide blocks the co-transporters for Na+ and Cl- in the ascending limb of the loop of ...
A: The drug butenamide is a loop diuretic whose main function is to block the Na+ k+ 2cl- co transport...
Q: Phenotype to Population: 1. Describe how the phenotype of individuals with sickle cell disease influ...
A: Sickle cell anemia is an autosome linked (recessive) genetic disorder.
Q: the following processes except a. alternative splicing to produce a secreted form of the T-...
A: Answer 1st answer - d) somatic recombination 2nd answer - d) CTLA4, SUPPRESSION
Q: Edmontosaur or hardosaurs what ways can they defend itself from predators like large with powerful j...
A: INTRODUCTION Endmontosaurs They are large dinosaurs lived in North America during late Cretaceous pe...
Step by step
Solved in 2 steps
- DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at FC or at room temperature. Longer spins make it difficult to resuspend cells. 2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at 4C or at room temperature. Longer spins make it difficult to resuspend cells. 2. Resuspend pellet in 100µl GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200µl NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150µl potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA. 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…BIOTECHNOLGY Date: Name: Instructor: Section/Group:. POST-LAB QUESTIONS 1. In one or two sentences, summarize the technique of gel electrophoresis. 2. How does the process of gel electrophoresis separate DNA fragments? 3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process? Biotechnology 165
- Copy and paste the link below and watch the video on Youtube and Answer the Questionshttps://www.youtube.com/watch?v=g-dNJdOvBM4 Polymerase Chain Reaction Questions: 1. What are the materials used for the polymerase chain reaction? 2. Draw a schematic diagram of the procedure in PCR. 3. Why is it important to design the primers at the start of the laboratory procedure? 4. What are the components of the PCR buffer and what is its pH range? What is the purpose of the buffer? 5. What is the use for magnesium chloride? 6. How much template DNA is added? What is the concentration of the primers? 7. At what temperatures does denaturation, annealing and extension occur? Why are the processes placed in that temperature? 8. In this particular PCR experiment, how many cycles was used? 9. Can this PCR be used on its own to find out if a person has Covid or not on its own? Why or why not?Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…all 224 811 468 61+ Time left •;•o Question IP Not yet answered Marked out of •.IFY Flag question What would be the effect on the PCR reaction if any of the following circumstances arose: 1) there are no primers in the reaction, Y) there are no DNTPS in the reaction, P") there is no Taq polymerase in the reaction? a. The reaction will cease after a few cycles b. The PCR reaction will not commence O c. PCR would proceed normally d. Non-specific PCR of random templates will occur
- Question one: PCR You want to amplify the underlined sequence, 1) Design Forward and Reverse primers to do so 2) Calculate the melting temperature for them 3) Calculate annealing temperature for them 4) Do you think your primers are high quality (Length, differences in melting between R and F, possibility of forming hairpins)? GTGTGCTGGTTATTCAAACAGATAAAAAAATTAAT CTATATGGTAATGCTCTAAGCCGCGCAAATACAG AATATGTGCCAGCCTCTACATTTAAAATGTTGAAT GCCCTGATCGGATTGGAGAACCAGAAAACGGATA TTAATGAAATATTTAAATGGAAGGGCGAGAAAAG GTCATTTACCGCTTGGGAAAAAGACATGAСАСТА GGAGAAGCCATGAAGCTTTCTGCAGTOCCCAGTCT ATCAGGAACTTGCGCGACGTATCGGTCTTGATCT CATGCAAAAAGAAGTAAAACGTATTGGTTTCGGTA ATGCTGAAATTGGACAGCAGGTTGATAATTTCTG GTTGGTAGGACCATTAAAGGTTACGCCTATTCAA GAGGTAGAGTTTGTTTCCCAATTAGCACATACACA GCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAA AAAATATGCTTCTTTTAGAAGAGAGTAATGGCTAC AAAATTTTTGGAAAGACTGGTTGGGCAATGGATAT AAAACCACAAGTGGGCTGGTTGACCGGCTGGGTT GAGAnswer the following questions related to PCR Bioinformatics for DNA Extraction using Why is it necessary to chelate the metal ions from the solution during the boiling/lysis step at 100 degrees celsius? What would happen if you did not use a chelating agent such as the InstaGene matrix? What is needed from the cells for PCR? What structures must be broken to release the DNA from a cell?וןווד ← Q Lab Report 6 worksheets 314 F22 .DOCX File Edit View Insert Format Tools Help A 100% ¿ Summary Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit Outline Headings you add to the document will appear here. Normal text Times ... 12 + B I U 2 18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows: 1 Restriction Enzyme(s) EcoRI BamHI HindIII EcoRI and BamHI EcoRI and HindIII BamHI and HindIII 3 Practice ====•=•€ EX Fragment lengths (base pairs) 430 bp, 375 bp 470 bp, 335 bp Lab Report 6…
- Gel Electrophoresis Background and Protocol: Gel electrophoresis is a laboratory technique that separates molecules by size using an electric current. The test has a positive and negative side. Do you believe DNA should be loaded on the positive (red) side or the negative (black) side? Please explain why using scientific reasoning. Will larger DNA bands be closer or farther away from the well where you administered samples? Why?1. Compute the volumes needed to complete this table. Stock Final Volume for Volume for 5x reaction Reaction Component Concentration Concentration 1x reaction sddH,0 up to 25 ul up to 25 ul Buffer (ViBuffer A) 10X 1X MgCl, 50 mM 3 mM DNTP 2 mM 100 uM forward primer 10 uM 0.2 uM reverse primer 10 uM 0.2 uM Taq polymerase 1 U/ ul 1 U/ 25 ul DNA template 1-2 ng 1 ul *5X reactions = 2 samples, 1 NTC, 1 positive control, 1 pipetting allowanceTranscribed Image Text:Complete the following tasks. You discovered that a species of bacteria can break down StyrofoamT (polystyrene) products due to an enzyme it produces, polystyrenase. You wish to study the gene that codes for this enzyme. Task 1: DNA Extraction To begin work on the bacterium, you begin by extracting its genomic DNA (GDNA). What is the purpose of the following procedures? Answer briefly but completely. Using sodium dodecyl sulfate, a detergent Answer: а. b. Adding RNase A and Proteinase K during extraction Answer: c. Adding ethanol before recovering the DNA extract С. Answer: Task 2: Polymerase Chain Reaction After purifying the gDNA extract, you want to isolate and amplify the polystyrenase gene. You perform PCR using the appropriate gene-targeted primers. What is the purpose of the following PCR components? Answer briefly but completely. DNA polymerase isolated from Thermus aquaticus Answer: а. b. Deoxynucleotide triphosphates (DNTPS) Answer: С. Forward and…