6. Describe what prompts a cell to produce interferon and the effects interferon has on the infected cell as well as surrounding cells.

Q: One ml of a sample was added to 99 ml of buffer. 100 µ of this was plated in nutrient agar. After…

A: A colony-forming bacterium is a microorganism that is capable of growing and dividing on a solid…

Q: Consider a cross of pea plants where RR is expressed as a RED flower, Rr yields flowers with both…

A: A monohybrid cross is a genetic cross between two individuals that differ in one trait which is…

Q: A B C D E F G Use the following tree to answer the question below. Which of the following trees, if…

A: A phylogenetic tree is defined as a branching diagram or tree that depicts the relationships that…

Q: The above product water molecules are generated in which eukaryotic cell compartment?

A: The question asks the location where water is produced in case of eukaryotic cells. We will find out…

Q: Provide an example of a passive immunity created artificially. How does the vaccinated person gain…

A: Artificial passive immunity is a form of immunization that involves the administration of pre-formed…

Q: 5. Below is the survivorship growth curve- (C) a) What does the x-axis on the graph in Model 2…

A: A survivorship growth curve is a graph that shows the number or proportion of individuals surviving…

Q: How does energy movee through an ecosystem from one trophic level to the next and what is the…

A: Energy flows unidirectionally through an ecosystem. It enters the food chain through primary…

Q: Why does inbreeding lead to an increase in recessive deleterious traits (for example inbreeding…

A: Breeding is the process of mating selected individuals of a particular species with desirable traits…

Q: Which of the following stimuli does NOT activate the inflammasome? O Endogenous cytokines O Viruses…

A: Inflammasomes are multimeric protein complexes that play important roles in the innate immune…

Q: 1. Explain BRIEFLY whether each of the following conditions will increase or decrease the chance of…

A: Note:- Since you have posted a question with multiple subparts, so we will be solving the first…

Q: discuss the method ATP-TOX as an old method and PCR as a new method for water biomentoring method…

A: Water biomentoring is the process of assessing the quality of water by measuring the physical…

Q: Which of the following is/are ways in which a single hormone can have multiple effects? There could…

A: Hormone are signal molecules that are produced by endocrine glands and bind to a specific receptor…

Q: 12) Use the diagram below and identify the parts of the graph labelled A, B, C, and D, respectively…

A: Enzymes are biocatalysts. Biocatalyst is made up of two words: Bio and catalyst. Bio refers to…

Q: Cells are made competent by treatment with CaCl2 O heat shock O treatment with recovery broth O…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Describe how methylation and acetylation of the histones changes gene expression in eukaryotes. What…

A: Chromatin, which is made up of DNA wrapped around histone proteins is the form in which eukaryotic…

Q: Given the phylogeny below: Fill in the table according to the principle of parsimony. For example,…

A: The table represents the principle of parsimony, which is a fundamental principle in evolutionary…

Q: 3. What 3 types of proteins will have a signal peptide? Where in the cell does translation of these…

A: Cell to cell signalling is the communication of information between cells. Cell signalling and…

Q: According to the FPH, the overall goals for Laura's program should be... To improve self-esteem,…

A: Based on the information provided, option 3 would be the most appropriate answer. The overall goals…

Q: List all the environmental impacts that occur during the "life span" of gasoline; that is, from…

A: Gasoline, also known as petrol, is a liquid fuel derived from crude oil that is used to power…

Q: How can developmental disorders affect the nutritional status of young children? 100+ words

A: Developmental disorders are the kind of disorders that occur during the development of a child. It…

Q: Between which two markers is the F factor located in strain 4? strain early late 1. 3. 5. O X and A…

A: This question is asking about the location of the F factor in strain 4. We need to identify the two…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: Question 4 please! I posted 3 for help on question 4

A: 4:A : Isolation mechanism are of outmost necessity to purify required elements. Using…

Q: Which of the following are potential uses for iPS Cells? O Development of patient specific therapies…

A: Pluripotent cells are a type of stem cell that have the ability to differentiate into any of the…

Q: The original concentration in a sample is 2.79 x 106 CFU/mL. Which sample volume should yield a…

A: Concentrated solution is the solution  which has large amount of solute present in it  Dilute…

Q: Which statement best describes the diagrams shown?  https://images.app.goo.gl/

A: Cell division is a process in which cell elongates and divides into two daughter  cells. It is very…

Q: ) Which of these are purines? a. adenine and guanine b. thymine, cytosine, and uracil c. thymine,…

A: The building blocks of DNA and RNA are called nucleotides and they are composed of nitrogenous…

Q: What specific “instructions” do COVID-19 vaccines provide our body cells? And  in what year did Dr.…

A: COVID-19 is the disease which is a pandemic disease caused by a virus belonging to the coronavirus…

Q: Amphioxus vs Ammocoete Larvae Pictures - what do they look like How is the anatomy & visual…

A: A interesting and challenging area of biology is the study of evolution and the genesis of species.…

Q: What is the consensus sequence that precedes a translation initiating AUG on messenger RNA? Answer…

A: The translation is the third process involved in central dogma for gene expression. It involves…

Q: If you are about to get into a car accident, how should your endocrine system respond? (What…

A: Hormones are chemical messengers produced by endocrine glands and secreted into the bloodstream…

Q: 2. List three factors that are contributing to the decline of pollinator populations. 3. From an…

A: Growing new plants from vegetative components of an existing plant, such as roots, stems, or leaves,…

Q: In order to discover the effects soils have on plant growth, three different soil samples will be…

A: A hypothesis is generally an explanatory statement that is used to predict the expected outcomes…

Q: 1. Hemophilia is due to a sex-linked gene. It is recessive and found on the X chromosome. A woman…

A: As per our guidelines, we are supposed to answer only- One question (If there are multiple questions…

Q: What information from the pet food manufacturer, distributor or trader should be found on the label?

A: Pet food labels are required to provide important information to help pet owners make informed…

Q: 1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in…

A: The DNA is the genetic material in living organisms that is responsible for the production of RNA by…

Q: 1. Circle the bonds in the drug molecule below that could be hydrolyzed by metabolic enzymes. OCH₂…

A: When an enzyme uses water to break a complex molecule into simpler substances then this process is…

Q: Memory formation depends on the synaptic plasticity of the hippocampal synaptic pathways. True False

A: Synaptic plasticity refers to the ability of synapses, which are the connections between neurons, to…

Q: When top-down control occurs within an intertidal zone along the rocky coastline of the Pacific…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: . Humans do not have the ability to digest fibre. If humans had the ability to digest cellulose,…

A: Biomolecules such as carbohydrates, lipids, proteins, etc. are essential for sustaining life.…

Q: MSH2 is a gene commonly associated with HNPCC (Hereditary nonpolyposis colorectal cancer). This gene…

A: Hereditary nonpolyposis colorectal cancer (HNPCC), also known as Lynch syndrome, is an inherited…

Q: 3) What defines the atomic number of an element? a. The number of electrons. b. The number of…

A: It is the number of protons in the nucleus.

Q: Genes control thousands of different traits in plants. These genes can be selected for during…

A: Traits are distinct characteristics or features of an organism resulting from the interaction…

Q: what are the applications of metabacording as a study of yeast in marine environments

A: Metabarcoding is a molecular approach that identifies and counts the variety of organisms present in…

Q: Which of the following traits has the greatest narrow-sense heritability? Circle the letter in the…

A: The proportion of the total phenotypic variation in a particular trait that is due to additive…

Q: Activity 4-Dihybrid Cross 1. Use the introduction of the dihybrid fruit fly cross to draw a dihybrid…

A: Inheritance forms the basics of the genetics. Inheritance is defined as the process of passing on of…

Q: During the cycling of neurotransmitters in the axon termini, the fusion of the neurotransmitter…

A: When an action potential arrives at the axon terminal it triggers the opening of voltage gated Ca2+…

Q: 4) Cells are made up of: a. Carbohydrates b. Lipids c. Proteins d. Nucleic acids e. All of the above

A: A cell is the basic unit of life, and it is the smallest structure capable of carrying out all the…

Q: ) Triglycerides make up the main form of lipid storage in: a. Plants b. Fungi c. Animals d. Mammals

A: A triglyceride is an ester derived from glycerol and fatty acids( three). Triglycerides acts as a…

Q: How many different types of gametes with respect to the R and B genes can an individual with the…

A: An individual with the genotype Rrbb has two alleles for the R gene (R) and (r) and one allele for…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.