C programming 6. The following C program cannot be compiled and would not display the correct output.There are four errors in it. Identify which lines contain the error(s), then re-write thecorrect way to write for each error.23123456789B101112 }// This is a program to calculate the area of a circle#include (stdio.h)main()float radius, area;printf("Radius = ?");scanf("%f", radius);area = 3.142 radius radiusprintf('Area = f', area);Error 1 at line-Correct way:Error 2 at lineCorrect way:-Error 3 at lineCorrect way:Error 4 at lineCorrect way:

Step 1: Error 1 at line 3The inclusion of the header file stdio.h is incorrect.Correct way: #include…

Answered: 6. The following C program cannot be…

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter3: Assignment, Formatting, And Interactive Input

Section3.2: Formatting Numbers For Program Output

Problem 10E

See similar textbooks

Similar questions

Write C++ statements to do the following: Declare an array to hold 7 floating values. Assign value 3.3 to the last element in the array. Display the sum of the first two elements. Write a loop that computes the sum of all elements in the array. Write a loop that finds the minimum element in the array.
Please rewrite the C++ code below according to the instructions and criteria. Thank you. Instructions Replace as many conditional statements in the 12 Days Of Christmas song with one or more arrays. Criteria compilation - the program compiles without error the first switch statement - replace the first switch statement with an array the second switch statement - replace the second switch statement with an array the if statement - rewrite the inner for loop by replacing the if statement and other statements in the inner for loop with references to these arrays:int last[] {-1, 0, 2, 3, 4, 5, 6, 7, 8, 9,10,11,12};int first[] {-1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1}; Code #include <iomanip> #include <iostream> #include <string> using namespace std; int main() { for (int day = 1; day <= 12; ++day) { cout << "On the "; switch (day) { case 1: cout << "first";…
2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…
: Write a program in C++ to input attendance as 0 (for absent) and 1 (for present) for 25 students in 32 lectures and store it in a 2-D array. After the input, write loops for calculating and displaying the index numbers of the students who has short attendance (i.e. less than 75%). Please enter attendance of all 25 students for given lecture (total 32 lectures): Enter attendance of Lecture “1” Student 1: <user enters 0 or 1> Student 2: <user enters 0 or 1> and so on….
(Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?
(Statistical) In many statistical analysis programs, data values considerably outside the range of the majority of values are simply dropped from consideration. Using this information, write a C++ program that accepts up to 10 floating-point values from a user and determines and displays the average and standard deviation of the input values. All values more than four standard deviations away from the computed average are to be displayed and dropped from any further calculation, and a new average and standard deviation should be computed and displayed.
When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error message
Based on the output below, create a C++ program that will include the new and delete operator. Interpret your program; you may include comments in interpreting your own program.SAMPLE OUTPUT: [Enter your own grades]Enter the number of grades to be processed:Enter a grade: 87Enter a grade: 88Enter a grade: 89Enter a grade:90An array was created for 4 integers The values stored in the array are:87888990
C++ - No library functions like atoi Write a machine language program to input two one-digit numbers, add them, and output the one-digit sum. Submit your "machine code" followed by a 'zz.'
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Example: Write a C++ program that calculates the sum and average of an initialized integer array. #include using namespace std;
C PROGRAM Write a program that asks the user values for the coefficient A,B, and C in the quadratic equation Ax^2 + Bx + C= 0, and then prints the solution/s of the equation (if there is/are any) For this problem, you need to include the following header file: math.h So that you can use the C library function sqrt() The function sqrt() computes the square root of a value (in double) Use #include <stdio.h>

SEE MORE QUESTIONS

Recommended textbooks for you

C++ for Engineers and Scientists

Computer Science

ISBN:

9781133187844

Author:

Bronson, Gary J.

Publisher:

Course Technology Ptr

Microsoft Visual C#

Computer Science

ISBN:

9781337102100

Author:

Joyce, Farrell.

Publisher:

Cengage Learning,

C++ for Engineers and Scientists

Computer Science

ISBN:

9781133187844

Author:

Bronson, Gary J.

Publisher:

Course Technology Ptr

Microsoft Visual C#

Computer Science

ISBN:

9781337102100

Author:

Joyce, Farrell.

Publisher:

Cengage Learning,

SEE MORE TEXTBOOKS