9. Which of the following mutations would be least detrimental to the function of a protein and why? 1) Silent; 2) Frameshift; 3) Deletion of two nuclcotides; 4) Nonsense; 5) Missense. mem
Q: 5. Consider the following DNA template strand: 3’ GCA- AAA-CAA-ATA-GTG 5’ Using the following…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…
Q: 7. Complete the table below by specifying where each of the indicated entities is found? Specify the…
A: Post-transcriptional modification is a process that follows after the transcription, where the newly…
Q: 6. Please describe the events that may result in a mature protein not having methionine as the…
A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…
Q: 4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a…
A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that contains coded genetic…
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a…
A: Let's consider an example: DNA strand - 5′-TAC AAA ATA CAG CGG-3′ mRNA strand – 5’ AUG UUU UAU GUC…
Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…
A:
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…
A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…
Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…
A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…
Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…
A: Sickle cell anaemia is an autosomal recessive disorder.
Q: Please describe the events that may result in a mature protein not having methionine as the…
A: Translation process of formation of a sequence of amino acid using messenger RNA as a template.
Q: What are the advantages and disadvantages of mutation?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…
A: Need to find which of the following is correct regarding RNA polymerase function.
Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…
A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…
Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…
A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…
Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…
A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…
Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…
A: All the living organisms contain genetic material. The genetic material is responsible for passing…
Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…
A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…
Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…
A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…
Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…
A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: What does it mean when we say the genetic code is redundant? a) A single codon can specify…
A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…
A: The translation is a process that is part of the central dogma that follows the process of…
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…
Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…
A: The proteins are produced from the mRNA by the translation process. This function is performed by…
Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…
A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…
Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…
A: The explanation for the wrong statement is given below.
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: Compare the structure and functions of DNA nad RNA.
A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…
Q: 3. What are the last three of six nucleotides (bases) of the palindromic site for the enzyme Ndel if…
A: Restriction endonucleases (or restriction enzymes) are enzymes that identify specific sequences in…
Q: C A T A C G C G T A с G
A: The given figure shows the process of DNA replication. DNA replication refers to the process of…
Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.
A: As you have not mentioned which part to answer, we are answering first three for you. If you want…
Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…
A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…
Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…
A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…
Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…
A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…
Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…
A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…
A: The DNA expression involves the protein synthesis which involves a series of events primarily the…
Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…
A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…
Q: Which of the following carries amino acids?
A: Ribonucleic acid (RNA) is a single stranded nucleic acid found in all living cells. Its different…
Step by step
Solved in 2 steps
- 1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one polypeptide. b) The 2'OH in the sugars of RNA is advantageous to the molecule to facilitate its hydrolysis6. Given: 3"--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (e)?7. a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.
- 1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutationGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
- 1. Below is a sequence of DNA bases. =T ACTICACGAGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA b) Translate to a sequence of amnio acids: Second Base Ala = Alanine Arg = Arginine Asn = Asparagine Asp - Aspartic acid Cys = Cysteine Gin = Glutamine Glu - Glutamic acid Gly-Glycine His Histidine lle - Isoleucine Leu -Leucine A G code amino acid code amino acid code amino acid code amino acid UUU UCU UAU UGU phe tyr cys UUC UCC UAC UGC C ser UUA UCA UAA STOP UGA STOP leu UUG UCG UAG STOP UGG trp G CUU CCU CAU CGU his CUC CC CÁC CGC C leu pro arg CUA CCA CAA CGA gin CUG CG CAG CGG G. Lys Lysine Met - Methlonine AUU ACU AAU AGU asn ser AUC ile ACC AAC AGC Phe- Phenylalanine Pro- Prolie Ser Serine thr AUA ACA AAA AGA lys arg AUG met ACG AAG AGG GUU GCU GAU GGU ThrThroonio hp fs 米 IOI 19 f10 11 12 ins Ins pr First Base Third BaseCH3 D) H,N-CH-c-o CH, CH-CH3 13. A silent mutation does not change the protein that is produced. B) has a very minor change on the protein produced (ie, Glu to Asp). C) has a major change on the protein produced (ie, Glu to Val) causes protein synthesis to stop due to a stop codon. A) D) 14. Which amino acid sequence is coded for from DNA with the coding strand sequence 5' AAG GCT AGT GGC 3'? A) Thr-His-Asn-Asp Gly-Ser-Ala-Lys B) Lys-Ala-Ser-Gly C) Asp-Asn-His–Thr D)9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release factors d) aminoacyl-tRNA synthetases
- 5. a) Describe, using a diagram or point form notes, what is happening during transcription and translation of protein synthesis. Indicate where these events take place in the cell. b) An error occurs in the transcription of the original master strand of DNA. At the very first base pair, a guanine is substituted for cytosine. State the possible effects on the polypeptide and its functions.6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
