a) L-fucose is also known as 6-deoxy-L-galactose. Note that D-galactose is a C-4 epimer of D-glucose. Draw the Fisher projections for D-glucose, D-galactose and L-fucose. (Hints: D- and L-isomers are enantiomers. 6-deoxy means that the hydroxyl group at C-6 is removed leaving just the methyl group). L-fucose D-glucose: D-galactose: (6-deoxy-L-galactose): b) L-fucose can cyclize into a pyranose and form two anomers. Draw the Haworth diagrams for the a- and ß- anomers of L-fucose. a-L-fucopyranose: B-L-fucopyranose:
Q: Discuss (as comprehensively but as concisely as possible) the role of protein folding in any (one)…
A: Since the question has mentioned to write about any one disease, I’ll write about (c) Cystic…
Q: Like other enzymes, arachidonic acid can be prevented from working by way of inhibitors. What…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…
Q: Make a summary
A: Glucagon is a peptide hormone secreted by the pancreas in response to low blood glucose levels.…
Q: What mass in grams of dextrose and sodium chloride are required to prepare 250 mL of D10 NS…
A: Introduction: The term molar mass is defined as the mass of one mole of a substance. It is…
Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and/or reaction…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Draw the structure of ethanolamine sphingomyelin formed from linoleic acid Draw the structure of…
A: Sphingomyelin is an important component of both the monolayer of phospholipids in lipoproteins and…
Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis…
A: Introduction: The pentose pathway is also known as the hexose monophosphate shunt (HMP) or…
Q: How can an unfavorable reaction (AG°¹ > 0) still occur in a metabolic pathway? By increasing the…
A: Metabolic reactions are the biochemical reactions that are essential for our cells to get energy…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: A. How many monosaccharide units are there? B. What is the specific glycosidic linkage labelled as…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: -11- E + SF k_1 ES ₂ E + P k2 › 10.0 + S ↓↑K IS ESS st Based on this model, please answer the…
A: The cessation of enzymatic activity is generally known as enzyme inhibition. It is generally of two…
Q: Pyrosequencing uses what reactants?
A: INTRODUCTION : Pyrosequencing : It is a process/technique of DNA sequencing ( which itself is the…
Q: Which enzyme activity would be inhibited if fluorodeoxyuridine-5 monophosphate is present?…
A: The compound fluorodeoxyuridine 5’-monophosphate (FdUMP) is a compound that has similar structure to…
Q: What is qualitative analysis of lipids? How important qualitative analysis of lipids in the field of…
A: Lipids are one of the 4 major groups of biomacromolecules. Lipids are a set of biomacromolecules…
Q: 9. PFS in erythrocytes, its biological significance, manifestations and consequences of…
A: PFA or progression-free survival is "the amount of time a patient experiences the diseases but does…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: What is the function of CTAB being added to the cell culture before performing the enzyme induction…
A: Cell culture is the propagation of cells by providing a controlled physiological and physicochemical…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to tetrahydrofolate by…
Q: NH4+ is transported indirectly in the body. Why can’t free NH4+ be transported in the blood? How is…
A: NH4+ is the waste product formed from the amino acids on their catabolism. It must be transported…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in…
A: Ionic detergents contain anionic or cationic head group long with their hydrophobic tails being…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: A. Effect of Enzyme Concentration Table 1. Effect of Catalase Concentration on Enzyme Activity…
A: "Since you have posted multiple questions, we will provide the solution only to the first question…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: A) what does the figure illustrate? B) Label the components in the figure pointed by the arrows and…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: The disease phenylketonuria is characterized by increased nervousness and fidgeting. elevated levels…
A: Amino acids can be degraded & certain amino acid can be interconverted to another amino acid…
Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…
A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…
Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…
A: The molecular weight of glyceraldehyde, a pleasant, white, crystalline solid, is 90.08 g mol 1. 29…
Q: (a) 2,3-Bisphosphoglycerate (BPG) reduces binding of O₂ to hemoglobin from almost hyperbolic to…
A: Hb is a protein responsible for carrying both O2 and CO2 in blood. 1 Hb protein is composed of 4…
Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…
A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…
Q: how did you get 0.03x10^-4? Also, what is the final answer?
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Provide the principle of biuret test used to detect RNA. Explain in 5 sentences essay
A: The biuret test is used to detect substances that have peptide linkages. To evaluate the aqueous…
Q: The catalytic efficiency of many enzymes depends on pH. Chymotrypsin, which has a well-known…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: true/false: The carbon skeleton produced by catabolism of asparagine enters glycolysis as…
A: Anaplerotic reactions are reactions that produce intermediates of TCA cycles. Conversion of…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme cellular…
A: Pyruvate kinase is the enzyme that catalyses the conversion of phosphoenolpyruvate to pyruvate. It…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are bio molecules that are made up of fatty acids and glycerol. They are insoluble in water…
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: Protein precipitation was seen in plasma samples that included ethanol solutions above a…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: INTRODUCTION : Glucose phosphorylation in Glycolysis - In the cellular mechanism of Glycolysis, the…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals…
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: Describe two reasons why the reaction glutamine synthetase performs is important to the body.
A: Cells can accumulate nitrogen in the form of ammonia from amino acid degradation, photorespiration…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Provide 3 reactions that facilitate the synthesis of oxaloacetate
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Step by step
Solved in 3 steps with 3 images
- 2B. S. aureus hemolysin B attacks the RBC cell membrane by hydrolyzing the sphingomyelin headgroup: ОН HN .R hemolysin B cuts this bond i) Draw a plausible mechanism of hydrolysis for this lipid headgroup. Let B- and BH be general base and general acid. 00-P-O LOR2 OR, ii) Why is this damaging to the overall membrane architecture of the RBC?8. Hypercholesterolemia is a frequent complication of diabetes mellitus in patients with prolonged hyperglycemia. Why a high level of glucose in blood causes hypercholesterolemia and atherosclerosis? For the answer explain: a) how glucose can interact with the proteins and the consequences of this reaction for the proteins; b) glycation of which proteins results in hypercholesterolemia; c) possible causes and complications of hypercholesterolemia.The figure shows interaction of various amino acids (Phe, Arg, and Asn) present in Hb with 2,3-DPG. The side chains of these amino acids and 2,3-DPG interactions are circled in red. HO Но Phe HN Asn H2N NH Arg You identify a mutant version of the globin chain where the Arg in circle 2 is replaced with aspartic acid in a patient. Would the Hb protein in this patient be able to transport oxygen even in the presence of 2,3-DPG? ASPARTIC ACID (asp) No, because the mutant Hb version will bind 2,3 DPG, and not oxygen Yes, because the mutant Hb version will bind 2,3 DPG, and not oxygen Yes, because the mutant Hb version will bind oxygen and not 2,3 DPG
- 4 A I. Refer to the figure below and answer the following questions: 45 5 55 6 65 PH 7 75 8.5 0 10 B 15 20 25 30 35 Temperature (°C) 40 45 Legend: Blue - wild-type ß-galactosidase; Red - mutant ß-galactosidase a. What is the optimum pH of wild type ß-galactosidase? b. What is the optimum temperature of mutant ß-galactosidase? c. Which enzyme has the greater activity at pH 7.2? d. Which enzyme has the greater activity at a temperature of 42.5°C? e. Which enzyme has greater activity if pH decreases from 7.5 to 6.4? f. Which enzyme has greater activity if temperature increases from 40°C to 41 °C? 50 55I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?Indicate whether the following sentences is either True or False and CORRECT if False : Monomeric α-catenin binds strongly to E-cadherin-β-catenin; and the dimer binds to intergrins.
- (c) Which phase of cell growth is disrupted by antimetabolites? Explain how as folate methotrexate functions antagonist. antimabolitesPolyethylene glycol (PEG)-conjugated IFNs have superior pharmaceutical properties compared with their unconjugated counterparts as a result of greater protection against proteolytic degradation, better solubility, and slower catabolism and excretion. Group of answer choices True FalseCo ? ull| 58%| 1:31 AM Topic 5_Proteins.. WMSU-ISMP-GU-001.00 Effective Date: 7-DEC-2016 See if you can do this! 1. Indicate whether each of the following molecules is an alpha amino acid or not and explain why. a. H,N-CH-C-OH b. H,N-C-CH,CH,CH; CH-OH ČH3 c. CH;CH;CH-CH,–NH, HO-C -CH-CH;CH(CH3)½ NH, d. OH 2. Which of the following forms of lysine would you expect to predominate at low pH, neutral pH, and high pH? H но H NH,- CH)4 NH,+ NH,- (CH)4 NH,- -C-O C-Ĉ-OH a. b. с. (CH)4 NH,+ NH, 3. One of the 20 standard amino acids is unusual in that its side chain contains a ring that incorporates the amine functional group of the amino acid. What is the name of this amino acid? What is its three-letter abbreviation and one-letter code? Write the chemical structure of this amino acid at physiological pH. 4. Draw the structure of valine at pH 1.0 and at pH 12.0. 26
- Classify the symmetrical arrangement ofthe subunits (e.g., C2 , C3 , D 2 , helical, icosahedral). 1. Proteobacterial nitrite sensor (3PNS):2. Pseudomonad oligosaccharide receptor (7POR):3. Adenoviral structural protein (8ASP)a. When a chromophore binds to proteins, the binding site is generally more hydrophobic than the solution. Then, what kind of shift do you expect to observe in the absorption peak position compared to the peak observed when the chromophore is free in solution?I. How much of a 10 mg/mL lysozyme stock would you need to add to 4 mL of cells for a final concentration of 1 mg/mL? What is the lysozyme doing?