Q: Tell me how this image shows the relation between grape and banana
A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…
Q: A character-based method that infers a phylogenetic tree by minimizing the total number of…
A: A branching diagram or tree illustrating the evolutionary links among distinct biological species or…
Q: The Amoeba, the paramecium, and the euglena ( These are unicellular Protozoans) produce electrical…
A: Protozoans are unicellular eukaryotes belonging to the kingdom protista. The structure of…
Q: Why is TP53 called the Guardian of the genome?
A: Instructions for producing a protein known as tumour protein p53 are found in the TP53 gene (or…
Q: This reflects the highest identification of the aligned sequences in the database to the sequence…
A: Aligned sequence refers to the sequence that is matched to the sequence present in the database.…
Q: A. DETERMINING Table 11-1. Osmosis experiment data: mass of bags (g) Time 0 min 15 min 30 min 45 min…
A: Bag no. 2, Bag no. 3 and Bag no. 4 are gaining mass. Water and sucrose molecules both are directly…
Q: Glycolysis occurs in what part of the cell? O eukaryotes: inner membrane of mitochondria;…
A: Question : Glycolysis occurs in what part of the cell ? Answer : Eukaryotes : cytosol ;…
Q: Below is a table of allele frequencies. Locus 1 Freq(116) = 0.3 Freq(120) = 0.4 Freq(124) = 0.3…
A: Gene frequency is the proportion of a specific gene or allele that is repeated over time in a given…
Q: Which of the following could not be used a a host cell receptor for viral entry? a.) LPS on…
A: What is a host cell receptor for viral entry? Each host cell carries specific biomolecules, known as…
Q: Figure 1. Maximum Likelihood Tree (branch style: traditional-straight) of Sardinella species…
A: The phylogenetic tree is a tree diagram showing the evolutionary relationships of organisms, how…
Q: Dichotomous Key Homework Use this Dichotomous Key and identify each of these seven leaves. You can…
A: Using the dichotomous key for the given leaves Following things can be concluded: (1):- It is a…
Q: Proton gradient Substrate level phosphorylation Calvin Cycle High energy electrons NADP+ Protons…
A: Cellular respiration is a group of metabolic events and procedures that supports in an organism's…
Q: Jean is the mother of Dani, Lelia, Jose and Pam. Alex could be the father, You use PCR analyze 2…
A: Agarose gel electrophoresis can be used for analyzing and sorting DNA fragments depending on size.…
Q: Create a word doc concept map
A: Concept may using the words givrn in the two pictures is given in step 2.
Q: Determining age at death for sub-adults is achieved by looking at the degree of epiphyseal fusion in…
A: Fusion of different bones occurs at age (years): Humerus distal end : 13-16 Femur proximal end :…
Q: Why do we study primates? Why is it important to study human evolution?
A: The study of anthropology is a broad one and covers a variety of topics. In its most basic form,…
Q: Indicate the number of nucleotide differences between the virus from Washington and the viruses from…
A: DNA and RNA are called as nucleic acids. The basic difference in the nucleotide sequence of DNA and…
Q: (3) If a DNA sequence is 5' TCC GGT CAT 3' what are the RNA and protein sequences that can be made…
A: Chargaff rule:The rule that in DNA there is always equality in quantity between the bases A and T…
Q: There are many metabolic pathways in a biological system, and it is critical to regulate these…
A: To increase or decrease end product output, single enzymes or all of the enzymes in a given pathway…
Q: Based on the dental development image from the previous question, this individual is at least _…
A: Eruption of teeth is useful in estimating age. The developmental characteristics of eruption and…
Q: Describe the diseases Strep Throat and Scarlet Fever in terms of the cause(s), the sign/symptoms,…
A: *Strep throat is caused by bacterial infection which can cause inflammation and pain in throat. This…
Q: he next several questions refer to the data given in this problem. You sample a population of…
A: Hardy-Weinberg equilibrium is a principle in population genetics that states the frequencies of…
Q: The pathway that can move highest rates of sodium ions is: A. Sodium channels B. Sodium…
A: Sodium ions are necessary in small amounts for some plants, but sodium as a nutrient is more needed…
Q: Explain how Ethnic Origin (regional ancestry) can be determined from bone but not “Race”. Explain…
A: Answer : Ethnic Origin (regional ancestry) can be determined from bone but not “Race” by clearly…
Q: Match the factor on the left with what it promotes on the right Mitogen Morphogen Death ligand…
A:
Q: Outline the general process of transcription (dna->rna) include a diagram a) include the basic…
A: Transcription is the process of synthesis of RNA from DNA. It involves three steps, initiation,…
Q: Hemocytes are stem cells which become red blood cells (RBC). The RBC's are filled with a protein…
A: Red blood cells (also known as erythrocytes) are the most common type of blood cell and are an…
Q: What causes ALS (i.e. mutation, chromosomal alterations, epigenetics, other)?
A: Amyotrophic lateral sclerosis(ALS) An estimated 5 to 10 percent of ALS cases are familial, meaning…
Q: Proteins that bind to a specific DNA sequence and help control the recruitment of RNA polymerase are…
A: DNA, or the deoxyribonucleic acid, is basically the hereditary material in humans and almost all…
Q: If the statement is made by a friend that both of my parents have trait X, and I do not so I must be…
A: Considering the situation where parents possess a trait X but child does not, we can guess that the…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: Introduction: The crossmatch test is a crucial component of the living donor evaluation and is…
Q: how is the rasberry is related to strawberry, banana and grape in a clade?
A: If fruit is developed from the ovary the fruit is known as the true fruit but sometime some other…
Q: Match the below with the correct descriptions Proteins that hold together two sister chromatids…
A: INTRODUCTION Answers to the match the following is given below.
Q: How does luciferin bind to the estrogen receptor if the drug tamoxifen is used to inhibit estrogen…
A: Tamoxifen binds to the estrogen receptor but does not fully activate it, stopping the growth that…
Q: WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't…
A: ANSWER) Apoptosis is described as the natural programmed cell death occuring in the multicellular…
Q: POSITIVE. GRAM- NEGATIVE. 2. Rods..... Cocci...... 3. Gelatin test positive.... Gelatin test ...Go…
A: Enterobacter cloacae is a clinically relevant Gram-negative, facultatively-anaerobic, rod-shaped…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: In a kidney transplant, a healthy kidney from a living or deceased donor is surgically implanted…
Q: The transportation of fatty acids into the mitochondria for oxidation occurs by...... O Facilitated…
A: The carnitine shuttle, which is made up of the enzymes carnitine-palmitoyltransferase 1,…
Q: woll bevange snow done to letmin & tibong maistups-miedomibase 5. You want to treat a 15-acre field…
A: The total area for which Lexar EZ 3.7SC is to applied is 15 acres. Rate of application is 3…
Q: Statement A: protein synthesis begins by the unwinding and unzipping of the DNA molecule in the…
A: The process of synthesis of proteins is called translation. DNA is first transcribed to form mRNA…
Q: next several questions all refer to the following problem. In dragons, the following are simple,…
A: Introduction:- Mendelian traits are characterized by the expression of their respective genes, which…
Q: how the Dual-energy-X-ray absorptiometry(DXA) and hydrostatic weighting to estimate the percentage…
A: Dual-energy-X-ray absorptiometry (DXA) for measurement of fat. DXA determines not only the precise…
Q: 1. Explain what primers are and what purpose they serve in a PCR reaction. Explain the main steps…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: A testcross percentage 10% 20% 40% 50% 60% 80% of AaBb gives 10% Aabb progeny. What of the progeny…
A: A test cross is so called because it is performed to test or identify the genotype of an unknown…
Q: Define each of the following terms related to describing/categorizing infectious diseases:…
A: These are the pathological terms related to a disease. Disease can be defined as the alteration of…
Q: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…
A: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…
Q: es Rationale
A: Most useful study would definitely involve the study which would prove beneficial for the mankind…
Q: Sample 1 Sample 2 Sample 3 Semp Sample 5 Is there DNA evidence to support the arrest of the accused…
A: DNA is unique to an individual. DNA fingerprinting also known as DNA profiling, is a technique of…
Q: O Cats O Dogs O Elephants O Humans O Spiders (like Charlotte in Charlotte's Web)
A: Semelparity is a type of reproductive technique. It is opposite of iteroparity.
Q: the evolution of complex animals is associated with the Annelids ( Earth worm), the mollusk (clam),…
A: Introduction Protostomes , Deuterostomes ,Cnideria and Proifera are different organism categories…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
Describe how you can determine if the gene is interrupted, and if so the number of interruptions by restriction endonuclesse analysis and southern analysis?
i did not quite understand your explaintion or the answer for this question
- 4.08 H H 1.02 2.54 11.021 E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H = Hindill site H 0.81 EE 1.76 1.10 Fragment sizes are not to scale and all fragment lengths are in kilobase pairs (kbp) Draw the appearance of the autoradiogram of the Southern blot after hybridization with a cDNA probe. IBelow is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…+1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? e
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…