A plasmid comprised of B-DNA changed its linking number from 550 to 502, resulting in a superhelix density of -0.045. What is the length of the plasmid in base pairs? 8765 3500 11200 12532
Q: What promotes coexistence between competing species? Predation, disturbance, and metapopulation…
A: Species It refers to the basic unit of diversity for classifying organisms. It is the group of…
Q: 4. The stage in mitosis in which chromosomes replicate themselves. A. Anaphase B Interphase D.…
A: Cell division is crutial process in all the organism both in unicellular or multicellular organism.…
Q: Why are cells small
A: Introduction Cells are the basic fundamental unit of life. All the organisms are made up of cells.…
Q: 7. How does gas exchange occur between the alveoli and capillaries?
A: Gas exchange occurs in millions of Alveoli in the lungs and surrounding capillaries which envelopes…
Q: What does this do to his fluid balance, electrolyte balance, specifically sodium, potassium, and…
A: Introduction Diarrhoea is a condition where the body's solid waste is discharged frequently in fluid…
Q: Which of the levels of organization is/are smaller than a cell? Provide an example of each.
A: Cell is the structural and functional unit of the life. It is the cell that forms the base of the…
Q: A culture is growth of microorganisms in a special
A: Nutrients are substances used in biosynthesis and energy production and therefore are requirea for…
Q: Please answer fast The human revolution may be characterized as ____. It is largely untenable as…
A: Human Revolution refers to a kind of transformation that accompanies complete change in the…
Q: 25. The cofor of orampt 24. The color of Gram 25. Bacteria are known negative bacteria is to…
A: Bacteria divide their cells through a process called bacterial binary fission. Although the notion…
Q: 1. Scott always drove you to Sally’s place for brunch, even though it was not far. One day you…
A: It has been observed that observational memories can affect the behaviour of a person even though…
Q: If secondary be classified active transport does not make use of energy, can it as passive…
A: Without the use of ATP, molecules are carried across and through the cellular membranes during…
Q: Explain the following areas about (kidney stone removal device) 1. What are the ingredients the…
A: The kidneys are reddish-brown bean-shaped organs in vertebrates. They are positioned at the left…
Q: Draw one red blood cell and at one white blood cell. Label the cell membrane, cytoplasm, chromatin,…
A: Red blood cells are biconcave discs( Round, flat and indented at the center) that lack nucleus. They…
Q: Is covid still a global threat
A: The virus that causes severe acute respiratory syndrome coronavirus 2 is the source of the…
Q: An allosteric regulator of glycogen synthase is: UDP-glucose. cAMP. glucose 1-phosphate. ATP.…
A: Introduction: The enzymes glycogen synthase and glycogen phosphorylase control the allosteric…
Q: Q3. Match the description with the correct concept. Interactions among organisms and between…
A: An ecosystem is a geographical area where plants, animals and other organisms work together.…
Q: One important difference between the anatomy of roots and the anatomy of leaves is that
A: A waxy cuticle covers leaves but is absent from roots.
Q: the relationship between mutation of RECQ5 and human disease, in particular exploring the effects on…
A: RECQ5:- it is a type of helicases. It is an ATP dependent helicase that can binds with single…
Q: Discuss two alternative agricultural practices that are environmentally friendly.
A: Introduction Sustainable agricultural practices are the techniques in which there is the most…
Q: In mammals adaptive immune system T cells receptor are extra ordinary numerous diverse what function…
A: Introduction T cells are mainly of two types T helper cells and T cytotoxic cells. All the T cells…
Q: Question 1 of 10 What enables a whale to move its fins in the ocean? A. Energy from the rotation of…
A: C. Energy directly from its food, enables a whale to move its fins in the ocean. The energy to…
Q: X Explain the following areas about (Ventilator) 1. What are the ingredients the device? الإنجليزية…
A: Ventilators: This are machines which are used for oxygen supply to the patients suffering from…
Q: Briefly describe how toe Bradford protein assay works
A: Introduction There are several methods to determine various biomolecules either quantitatively or…
Q: about two Practice Practice creating a dihybrid cross are dominan characteristics in pea plants,…
A: Dihybrid cross: - A Dihybrid cross is defined as a cross between two individuals who differ in two…
Q: What is scientific consensus
A: Basically, a consensus defines a general agreement on a particular subject or matter. A example of…
Q: Researchers investigating the role of fat metabolism in diabetes generated PPAR peroxisome…
A: Knockout mice is a mice where a specific gene is turned off that is it is unable to form a desired…
Q: n Cohen-Boyer’s recombinant DNA procedure, ___i___ must be used for both the bacterial DNA and the…
A: The Cohen-Boyer experiment was to construct recombinant plasmids carrying the rRNA gene from the…
Q: what is the correct order of the phases of an action potential
A: Introduction: The resting membrane potential, often known as the resting potential, is a voltage…
Q: Starting with One Cell describe and draw step by step the process of Meiosis I in males and females…
A: Reductional divisions is another name for meiosis I. Meiosis is used by both males and females to…
Q: Why does puberty occur too late or too early in some individuals?
A: Puberty is a crucial stage in human development, marking the transition from childhood to adulthood.…
Q: Explain the following areas about (anesthetic device) 1. What are the ingredients the device? 2.…
A: Introduction Anesthesia is a regulated, short-term loss of awareness or feeling that is induced for…
Q: Determine the reason due to which it is possible that the translation of a single mitochondrial…
A: Given that tRNAs are impacted by numerous clinical mitochondrial illnesses brought on by mutations…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: In this question, Hardy Weinberg equilibrium will be applied which is also known as the Hardy…
Q: To see the entire chart, please click on it with your cursor and click the right arrow key several…
A: How are organisms classified according to hierarchy? Each of these levels of the hierarchy is called…
Q: 1. There are four groups of plants. Each plant can be EITHER vascular or non-vascular and EITHER…
A: There are four groups of plants. This includes- Moss (Bryophytes) - They are non-vascular and…
Q: What is a model organism? A. used by science to be an example for how other organisms would respond…
A: Organism is a living being who is made up of cell or more than one cell. For example: Bacterial…
Q: What would happen if the heron population rapidly declined
A: Herons: They are birds having long necks and long legs. They are found near the water bodies. We…
Q: ➤ Question 22 3 points Save Answer A plant has the following characteristics: a taproot system,…
A: Introduction The kingdom Plantae contains eukaryotes that are mostly photosynthetic. Algae and…
Q: Give some hazard of prenatal development
A: Prenatal development is a critical time for the developing individual. It is during this time that…
Q: Describe the activation of the β2 (beta2) adrenergic receptor, and briefly explain how this leads to…
A: Introduction :- Adrenergic receptors are cell surface receptors that become active when they contact…
Q: What are four key qualities that must be maintained by homeostasis?
A: The concept of homeostasis is the maintenance of equilibrium throughout a living thing's body. It…
Q: Answer the following genetic problems.
A: Chi square test is used to find the significant differences between the two characters that is…
Q: ACTIVITY :- Prepare a flow chart on type of Microorganisms and draw suitable labelled diagram and…
A: Introduction Microorganisms are small organisms that are not seen by the naked eyes. They are…
Q: What structural and biochemical changes does the spermatid undergo during permiogenesis? How do…
A: spermiogenesis is the final stage of spermatogenesis that involves maturation of spermatids into…
Q: As part of any scientific study, a scientist will only change one dependent variable at one time.…
A: Dependent and independent variables Dependent variables are those that depend on some other…
Q: Which of the following statements is FALSE about the long-term evolution experiment (LTEE) that you…
A: Introduction Evolution is the gradual change in the inherited traits of biological populations over…
Q: Cystic fibrosis is an autosomal recessive disorder that affects 1 in 3 000 newborns with Caucasian…
A: Cystic fibrosis (CF) is an inherited disorder that causes severe damage to the lungs, digestive…
Q: Explain how your body monitors its hydration levels
A: Introduction: waste products can be dissolved in water, which then allows them to leave the body…
Q: Summarize the mRNA translation steps of protein synthesis, which are: initiation, elongation, and…
A: Translation is the process of synthesis of proteins from mRNA.
Give a clear handwritten answer...?
Step by step
Solved in 2 steps
- A plasmid comprised of B-DNA changed its linking number from 420 to 457, resulting in a superhelix density of 0.031. What is the length of the plasmid in base pairs? 15050 11200 3500 12532 8765A Plasmid is 3.6kb large. It is digested with an enzyme that has restriction sites at 1,152 and 2,954. How many fragments do we have and what are their sizes?Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
- How many microliters of the pGLO plasmid do you need if you want 5 micrograms of DNA and the plasmid concentration is 100 nanograms/microliter?A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
- 27. Given the following plasmid map, list how many fragments would exist and their bp length when treated with Hindll and Nde1 Dail 91 Ben BI 51 EstAPI 179 BemBI 2683 Ndel 183 Kasl - Narl - Sfol 235 Bgll 245 Fspl 256 Pul 276 EcoO1091 2674 Aatll - Zral 2617 BiM 2542 Sspl 2501 Prull 306 Benrl 364 Acll 2297 BæAl 387 Apol - EeoRI 396 Xmnl 2294 lacza haall - Sacl - Ecos3KI 402 Accbs1 - Kpnl 400 Awal- BsoN - Smal- TapM I- Ymal 412 Beal 2215 MCS Scal 2177 haml 417 Xhal 0 Pvul 2066 Accl - Hinl - Sall 29 pl. Alau a sb 434 Avall 2059 PUC19 2,686 bp BerDI 1985 Sphi 441 Hindi 447 Acll 1924. Fspl 1919 Prull 628 Avall 1837 Til 641 EsaXI 659 me AllI 1822 Rgll 1813 Bpal 1784 BSPOI - Sapl 683 BsrFl 1779 Bsal 1766 Thl 781 AII - Peil 806 BerDI 1753 Dal 908 Bmrl 1744 ori Aldl 1694 BkiM 1015 BseYl 1110 AlwNI 1217 BeeN 1292 dyWhat is the role of ‘Ori’ in any plasmid?a) A plasmid DNA in bacteria has a length of 14,000 bp and an Lk of 1300. Calculate the superhelical density o for this plasmid. Show your work for partial credit, round to one digit after the decimal point. b) You use a Type II topoisomerase to change the linking number of this plasmid to 1310. How many turnovers must the topoisomerase perform? Is this resulting plasmid underwound or overwound?
- 22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.You have two cell cultures, each containing a different plasmid. The first plasmid is ~5kbp long and contains three 5'-TCGA-3' and the other is the same size, but only contains two 5'-TCGA-3' sequences. You forget to label the two cell cultures you grew and have to figure out which one contains each plasmid. How would you go about identifying the the two cultures.