(a) Processive synthesis 1. (b) DNA unwinding 3'= MINNNNNNNNN (c) Helical DNA untwisting 3' 2 5 (d) RNA priming 3'= (e) DNA sealing செகண ம ம் . Nick முரும் டிய 53 35 5% 3 5 3% 53 MIMINNS PINNENNDI 3′ DNA underwound Primer ந
Q: The enzyme MM12 is manufactured and secreted by white blood cells. MM12 fights and kills bacteria…
A: Introduction White blood cells, also known as leukocytes, are a type of blood cell that plays a…
Q: a primary reason that enzymes are necessary to life is that a. the are portenin coded for in DNA…
A: Enzymes are high molecular weight proteinaceous biomolecules involved in almost all biochemical…
Q: . An obligate aerobe growing in an oxygenated environment is suddenly moved to an environment…
A: Obligate aerobes are organisms that must have a constant supply of oxygen to perform their metabolic…
Q: In order to unravel the mysteries of human genetics scientists have studied the genetics of many…
A: "Scientifically testable" means that a hypothesis or question can be tested through empirical…
Q: Wild type SSL2 reference sequence from amino acid 621 through 680 621 Lys Met Gly Lys Pro Phe Ile…
A: The term "Mutation" can be defined as the random and sudden inheritable changes in the DNA sequence…
Q: 145. A 25-year-old woman comes to the physician because of a 5-day history of yellow skin and…
A: Viruses are nonliving entities that are neither categorized into prokaryotic domains nor in the…
Q: 2. What is NAD (NAD+) and NADH? Describe them as if you were a chemist. Why is NAD needed by all…
A: Nucleotides are organic molecules that serve as the basic building blocks of nucleic acids such as…
Q: True or False. Explain. A) At no time during protein synthesis does an amino acid make direct…
A: Nucleic acid is a type of macromolecule present inside the nucleus of cell which is involved in…
Q: Create a flowchart to show the similarities and differences between the 3 major categories of…
A: Carbohydrates These are the most common type of organic compounds that are used to store energy.…
Q: Complete the following table by listing the dominant life stage (gametophyte or sporophyte) for each…
A: Bryophytes are small, non-vascular plants that lack true roots, stems, and leaves. They are commonly…
Q: Where does the splintering within come from?
A: The term "splintering" generally refers to the process of breaking into smaller pieces or fragments.…
Q: Step by step Protein Hormone Synthesis
A: Introduction :- Proteins are complex macromolecules made up of amino acids. They are essential to…
Q: Conduction of action potentials in myelinated axons group of answer choices requires more energy…
A: Introduction :- Aerobic respiration is a process that requires oxygen and occurs in the mitochondria…
Q: Which of the following describes a bacterium that lives in the human intestine and causes disease?…
A: Introduction Disease refers to any abnormal condition or disorder that affects the body or mind of…
Q: What role does the cohesive nature of water play in living systems? Give at least three examples.
A: Introduction Living systems refer to biological entities that exhibit characteristics of life, such…
Q: In the traditional alkaline lysis method, what is the purpose of SDS in sokution 2?
A: A bacterial cell has additional circular DNA (called plasmid) in addition to the chromosomal DNA.…
Q: Match the term with its energy source. Primary Active Transport Diffusion Facilitated Diffusion…
A: Introduction ATP stands for adenosine triphosphate, which is a molecule that serves as the primary…
Q: During RNA processing _______ are spliced out by snRNPs which recognize a _______. introns;…
A: Proper RNA processing is crucial for the generation of functional mRNA molecules that can be…
Q: What exactly is the significance of the abbreviation DFR?
A: Introduction Enzymes are proteins that catalyze or speed up chemical reactions in living organisms.…
Q: high and low affinity binding sites require the same amount of ligand to achieve saturation true or…
A: Introduction A ligand is defined as any molecule or atom that binds to a protein molecule known as…
Q: Prior to submitting your candidate's DNA for Sanger sequencing, you performed a colony PCR reaction…
A: Sanger sequencing is a very important technique and needs to perform with certain protocols. If we…
Q: In the transduction pathway, protein kinase C (select all that apply): O Is activated by the second…
A: Introduction : Cell to cell signalling is the communication of information between cells.…
Q: Provide a specific, common example of each type of plant, preferably one that you have in your…
A: ANSWER) Plant Kingdom has a vast variety of plants which are classified into different groups which…
Q: 20. A dried blood spot can be collected using a cotton swab moistened with A. EDTA C. distilled…
A: Introduction :- Aspermia is a condition in which no spermatozoa are present in the seminal fluid,…
Q: what kind of experiment would you carry out to prove or disprove your Alternative Hypothesis H1?
A: The Chi-squire test is done for prove or disprove alternative hypothesis.
Q: Gated channels in the membrane of the endoplasmic reticulum open as a result of Save for Later PIP2…
A: Introduction The endoplasmic reticulum (ER) is a complex network of membranes that are found within…
Q: In rho dependent transcription termination the rho factor binds to? You have a 18 ml sample of…
A: Introduction :- A zygote is the initial cell formed when two gamete cells (sperm and egg) fuse…
Q: What is BLAST and How did it improve upon the alignment methods used previous to its development?
A: BLAST (Basic Local Alignment Search Tool) is a widely used software tool for comparing biological…
Q: the most widely distributed plasma-membrane effector protein in cells is adenylyl cyclase true or…
A: Introduction: Adenosine triphosphate (ATP) is transformed by adenylate cyclase (AC) into…
Q: What triggers the release of acetylcholine from a synaptic terminal?
A: Note:- Sorry, please note that as per our company's honor code, we are allowed to author only the…
Q: Where are the secondary and tertiary structures of acid hydrolase completed? Question 6 options:…
A: Introduction :- A lysosome is a membrane-bound organelle found in most animal cells that contains a…
Q: 12. What temperature is used to break the antibody-antigen bond? A. 25°C C. 54°C 13. In the last…
A: Introduction: Antigens and antibodies are essential components of the immune system that work…
Q: An enzyme reversibly binds a substrate. The rate constant (kcat) for catalytic conversion of enzyme-…
A: The enzymes are the proteins involved in increasing the rate of the reaction by acting as a catalyst…
Q: General charecters and Lap diagnosis of gooze parvo-virus ?
A: Introduction Viruses are microscopic infectious agents that can infect and multiply within the…
Q: How many DNA strands are present in the nucleus of a liver cell in humans?
A: Introduction DNA stands for Deoxyribonucleic Acid. It is a carries genetic information. DNA is…
Q: A bacterium that lives in the human intestine derives its nutrition by digesting the contents of the…
A: The system of bacteria in a person's digestive tract is known as the gut microbiota. Many bacteria…
Q: SAY IT WITH DNA: PROTEIN SYNTHESIS WORKSHEET: Practice Pays Student Handout Having studied the…
A: The DNA message is read in codons that contain three nucleotides. The DNA is transcribed to create…
Q: The Enzyme Lactase Experiment Design How does pH affect how lactase drops work to break down lactose…
A: Introduction :- Enzymes are biological molecules that act as catalysts to accelerate chemical…
Q: Draw a side-by-side comparison of mitosis and meiosis. Include 6 chromosomes in your drawings at the…
A:
Q: Two cartons of juice are the same price one is 2qt and the other 250ml which is the better bargain?
A: Sugar: Sugar is a type of carbohydrate that is commonly used as a sweetener in food and drinks. It…
Q: are evolution and religion naturally incompatible ? agree or disagree and explain why.
A: Evolution is the scientific theory that describes how species of organisms change over time through…
Q: How do you know if you Azotobacter bacteria isolation was successful? Could you please list all…
A: Azotobacter is a genus of free-living, nitrogen-fixing bacteria that are found in soil and water.…
Q: Give me a sample of bracketed dichotomous key for identification of any species
A: A dichotomous key is a tool used in biology to identify and classify organisms. It is a series of…
Q: Why is it important for the diet to provide enough carbohydrates in order for the body to be able to…
A: Introduction Carbohydrates are one of the three main macronutrients (alongside proteins and fats)…
Q: A 2-year-old is eating lunch and says, "Mommy, more." This is an example of: O telegraphic speech O…
A: Answer is -- Infant directed speech
Q: Functional RNAs such as snRNA and tRNA are used in the cell as RNA molecules. These molecules go…
A: Functional RNA refers to a class of RNA molecules that are transcribed from DNA and have specific…
Q: the sequence of amino acids in a protein is known as the secondary structure true or false?
A: Amino acids are the basic building blocks of a protein. There are 20 types of amino acids out of…
Q: Explain the defining characteristics that exist between the six different classifications of…
A: Protozoa are a diverse group of single-celled, eukaryotic microorganisms that are found in many…
Q: How would you respond to a friend that wants to know whether regular or diet soft drinks are…
A: Introduction Nutrition is the study of how the body uses food to maintain health, grow, and…
Q: Which of the following statements correctly describes a process by which bacteria become resistant…
A: There are two statements which describes a process of build up antibiotic resistance of bacteria.…
Q1: ALL DNA synthesis starts from primers… and
Q2: Name the enzymes and proteins from 1-6
Step by step
Solved in 2 steps
- Please label the following: (A) INITIATION *Complementary strand *Template Strand *RNA polymerase *Initiation Site *Termination Site *Promoter *5' and 3' end on each DNA strand Initiation (A) FRA FORÆTSIST Elongation (B) (C) restorag Termination IND PLATIN RNA (B) ELONGATION *Exiting DNA *Exiting RNA Transcript *Template Strand *Nucleotides (ATP, UTP, CTP, GTP) *Direction of transcription PHILLI 13' DIDIJILLule should [1] De Tepicated exactly. Figure 2 represents part of a DNA molecule. 5'TT ATGC TT 3' T. C CA G tal: 5] TACG A A G 3' GTC her 5' Figure 2 (c) Show, by means of annotated diagrams, how this piece of DNA is replicated. Distinguish clearly between the original and new strands.You prepare a reaction mix containing (i) DNA polymerase III, (ii) DATP, DCTP, dGTP, Mg2+, and 2,3'dideoxy-TTP (called ddTTP*), (iii) a short primer with the sequence 5'-CCTG-3, and (iv) a source DNA fragment with the sequence, 5'-AATCGTTCACGTTAGCAGG-3. What is the product of this reaction? Note that in ddTTP, both the 2' and 3' positions on the ribose sugar lack hydroxyl groups. No reaction, because the primer is not complementary to any sequence in the source DNA. O CCTGCT O CCTGC O T'T'AGCAAGT'GCAAT CGTCC O CCTGCT'AACGT GAACGAT'T
- 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…22..2 if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence: 3’ UACGCA5’ 3’AUGCGU 5’ 3’ ATGCGT 5’ 3 TACGCA 5’ 3’ ATGCGT 5’of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
- (a) How fast does template DNA spin (expressed in revolutions per second) at an E. coli replication fork? (b) What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme relative tothe template?5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
- smolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.DNA synthesis by DNA polymerases exemplitiės Q6 DNA synthesis Growing strand Template (primer) strand DNA polymerase G NH DNA primer Mg2+ NH2 Asp- Asp- 5' P-0 3' OH OH Mg2+ Incoming DNTP H. Incoming DNTP 0-P=0 Mg H. Mg CH H. Can you' rationalize or explain why dNTP (deoxyribonucleotide triphosphate) instead of DNMP (deoxyribonucleotide monophosphate) has been selected by evolution as the reactant and a DNA polymerase is also required to catalyze the reaction (to a reasonable rate of ~1000-events per second) in living systems? Hint: Ea of the reaction without catalysis is about 30 kcal/mol.