A small section of a gene for a protein has the following nucleotide sequence: CTG GGA TCC TAA GGT Which of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine base

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…

A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…

Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…

A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…

Q: Each of these six terms fits into one (and only one) of the following blanks:  bases, proteins,…

A: Gene regulation involves cellular processes that control the rate and manner of gene expression. A…

Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…

A: The tRNA is responsible for transferring amino acids at the site of translation or protein…

Q: Which of the following describes the interactions between a codon and an anticodon? A. A codon and…

A: Codon is in mRNA (messenger RNA) and anticodon is in tRNA (transfer RNA).

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Which one of the following statements is true? Select one: O a. It takes three genes to code for one…

A: Gene can be defined as the segment of DNA. It contains information about the genetic characteristic…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: Which one of the following statements is true? Select one: O a. Each gene codes for three proteins O…

A: In order to form proteins, DNA codes for m RNA and t RNA through the process of transcription. Both…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…

A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: Which of the following describes the effect of a frameshift mutations? *   A. all mRNA codons change…

A: Cental dogma is the process via which DNA is transcribed into mRNA then the mRNA is translated to…

Q: Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B.…

A: ANSWER;-  B). A +3 frameshift mutation Explain;- A frameshift mutation is a type of mutation…

Q: Which of the following describes the most likely effect that a single base substitution in the…

A: Point mutation It is a type of genetic mutation in which a single nucleotide base gets altered,…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain…

A: A nonsense mutation is defined as the process of the substitution of only a single base pair. This…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…

A: No, this mutation might not change the way in which the protein functions. In this mutation the…

Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…

A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…

Q: Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the…

A: The protein is synthesized by the process of translation. It takes place in the cytoplasm of the…

Q: A single base substitution mutation is likely to have a less harmful effect when the base change…

A: Point mutations are the mutation which cause change in nucleotide base at specific position . It can…

Q: Although ultimately coding for all aspects of a protein, the gene codes directly only for what level…

A: DNA is made up of many nucleotides. Each nucleotide is made up of phosphate , a pentose sugar, and…

Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…

A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: result

A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…

Q: There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs.  This is best explained by…

A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…

Q: Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of…

A: In genetic code, the following terms have specific meaning. These are- 1. Unambiguous- Genetic code…

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: The peptide bond formation a. occurs when two tRNAs are located inside the P and A site in the…

A: Given: The peptide bond formation.

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…

A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…

Q: A mutation caused by a base deamination or a tautomerization is called a a. silent mutation b.…

A: Mutation- any changes in the gene which causes abnormality is known as mutation Deamination-…

Q: A gene is a piece of DNA that codes for a protein.  Genes are transcribed into mRNA and are on the…

A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…

Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…

A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…

Q: How might a single base substitution in the sequence of a gene affect the amino acid sequence of a…

A:

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…

A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: NOTE:- As you posted multiple parts under one question, we will solve the first three for you, to…

Q: Which of the following would probably cause the most severe damage to a gene's expression and…

A: A phenotype is expressed by a gene by the process of transcription of the gene from DNA to make an…

Q: . Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base…

A: A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…

Q: In the image below, the blue squiggly line represents a folded protein. There are two particular…

A: Protein is a nitrogenous organic macromolecule that is crucial to human health. It is responsible…

Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…

A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…

Q: A single base substitution mutation is likely to have a less harmful effect when the base change…

A: A single base substitution mutation is also known as the point mutation which changes a single base…

Q: Which of the following changes to a DNA sequence would cause a frameshift mutation? OA. The…

A: Mutation are the changes that arise due to abrupt change in sequence of base pairs. It may be a…

Q: codon

A: The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time…

Q: Which of the following describe how the order of nucleotide bases along a gene in the DNA ultimately…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…

A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.