A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
Q: Write a sentence describing the role of each of the following types of RNA in gene expression.
A: mRNA - Messenger RNA (mRNA) is a single-stranded, complementary RNA molecule to one of the gene's…
Q: Which of the following is TRUE about eukaryotic gene expression?
A: Eukaryotic Gene Expression is one of the most complex processes because every cell in the body had…
Q: Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia…
A: In codon 34, CAC codes for the amino acid Histidine. CAC is replaced by GAC which codes for Aspartic…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…
Q: Outline in a single sentence the sequence of event that must take place for a protein to be…
A: A compilation of membranous formations required for transportation inside the cell. The principal…
Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…
A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…
Q: My textbook says:"Protein encoding genes control protein production indirectly, using a related…
A: Proteins are made of structural building blocks called as amino acids and are found in all cells and…
Q: Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is…
A: Nucleic acids are large molecules made up of nucleotides that help to build proteins and to express…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA…
A: Any modification of a cell's DNA sequence. Mutations can occur as a result of errors made during…
Q: lactose is present in a cell with the following genotype, will functional Beta – galactosidase…
A: Lac operon is used by Ecoli to metabolize lactose when glucose is not available It produces beta…
Q: Both ADA-SCID and type I diabetes are diseases based on lack of a particular protein. Why has the…
A: ADA means Adenosine deaminase deficiency and SCID is severe combined immunodeficiency. ADA-SCID is…
Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: a) Two of the following three mRNA sequences code for the same protein. Delete the sequence which…
A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…
Q: Why the process of DNA is transcribed into mRNA and then translated into protein is referred to as…
A: Note - we are supposed to answer 1 question according to the guidelines. Please repost the other…
Q: Peptic Ulcer, Is this a genetic disease? If so, do scientists know if it is dominant or recessive?…
A: More than 20% of patients show a family history of duodenal ulcers. They drawn were compared with…
Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…
A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' 1. Where N stands for any nucleotide, give…
A: *Given DNA sequence is 3'-TACTTNGTNCTNTCN - 5' 1* Here N will be any nucleotide so take Him place…
Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5'…
A: According to the question, we have to write down the messenger RNA sequence ad the polypeptide chain…
Q: In order to manufacture insulin for patients with diabetes, scientists create recombinant DNA by…
A: The insertion of normal gene into the genetic material of any organisms like common bacteria are…
Q: I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver…
A: Cancer is the condition of uncontrolled cell division.
Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…
A: Given: DNA sequence
Q: Like Hurler syndrome, Fabry disease involves an abnormal accumulationof substances within lysosomes.…
A: Fabry disease can be defined as the type of rare genetic disorder in which there is an accumulation…
Q: which one would be least likely to cause Liam’s disease? Group of answer choices A. Mutation 4 B.…
A: Promoter: Is short nucleotides sequences located at 5'end that aid in switching on and off of a…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA…
A: DNA is the genetic material present in the cells of living beings.
Q: What do you predict would be the consequence of a mutation in FtsZ that disrupts the function of the…
A: FtsZ is a protein found in the prokaryotes as well as some eukaryotes which are encoded by the ftsZ…
Q: What region would provide cell type-specific expression of genes? region What site would…
A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.
Q: Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration…
A: The translation is a process of conversion of RNA codon sequences into their respective amino acid…
Q: B-thalassemia is a hereditary blood disorder that leads to the formation of an abnormal hemoglobin…
A: Answer is option A.
Q: Baby Y has been diagnosed with the Graham-Snavely mutation. This mutation produces a disorder with…
A: Transcription is the process that refers to the formation of mRNA (messenger ribonucleic acid) which…
Q: Shown below is the genomic structure of the wild-type gene for the human gene transthyretin. The…
A: Introduction: A nucleotide is an organic molecule that is the building block of DNA and RNA. They…
Q: Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA…
A: In the formation of mRNA from DNA, base complementarity rules follow. A pairs to U and T pairs to A.…
Q: Suppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: three different types of loss of function mutations and in each case explain how the mutation exerts…
A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…
Q: GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence…
A: The flow of the genetic information is from DNA to RNA and RNA to protein. This flow of genetic…
Q: How would a DNA codon sequence influence the shape and the expression of the allele
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: Like Hurler syndrome, Fabry disease involves an abnormal accumulationof substances within lysosomes.…
A: Gene is a functional unit of heredity. A gene is a sequence of nucleotides in genome that codes for…
Q: Which of the following processes regulates the maturation of mRNA from hnRNA (in the control of gene…
A: mRNA In the world of RNA, mRNA is a type of RNA which contains codon in the form of triplets. These…
Q: Exon duplication of multiple repeating subunits is thought to be responsible for the origin of which…
A: Vertebrates have a spinal cord that remains surrounded by bone or cartilage. Mammals are vertebrate…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: A gene is transcribed in a fibroblast and a chondrocyte, but the primary structure of the encoded…
A:
Q: The coding sequences of Gene F' and Gene G' are shown by the double-stranded DNA shown below: Gene F…
A: The process in which the DNA is transcriped into m RNA is called transcription and the mRna is…
Q: Which of the following scenario will result in greater consequences in terms of gene expression?…
A: Gene expression is basically the process in which the gene (contained typically in a DNA) is…
Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…
A: In molecular biology, mRNA is a single-stranded molecule of RNA that corresponds to the genetic…
Q: would a nonsense mutation at the beginning of the gene, or at the end of the gene, have a greater…
A: Nonsense mutations occur when premature nonsense or stop codon is introduced in DNA sequence. If the…
Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: How would a human cell normally change its expression of the gene for tyrosine aminotransferase?…
A: The function of a gene can be studied through expression in a particular cell and its interactions…
Q: does DNA encode the instructions to make us? Select all the true statements. Group of answer choices…
A: DNA is necessary for all living things, including plants. It plays a role in heredity, protein…
Q: Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene…
A: Sometimes, the levels of protein and mRNA of a particular gene will not match. The mechanism behind…
A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new
3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’
what type of mutation is this?
Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
- Indicate whether the following sentences is either True or False and CORRECT the wrong sentences ( please answer the two questions 1 and 2) : 1. People having defective APC gene are more susceptible to developing polyps (benign tumors) in the colon, and such APC mutations can arise spontaneously or be triggered by environmental mutagens. 2. Monomeric α-catenin binds strongly to E-cadherin-β-catenin; and the dimer binds to intergrins .Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-GlA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-ProA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationIf we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’