a. Cl–CH;–CH,-CH–CH3 CI b. CH;CH;CH;CCI, c. CH1 CCI-CH-CH-CH3 CH, CI CH2-CH3 a. CH;PCH;F
Q: nswer these questions plz
A: Nursing theory As we know It explains or describe health and associated influencing factors with the…
Q: Does the COVID-19 vaccine contain the virus? I need full depth explanation for this question. Please…
A: mRNA vaccines These are a type of vaccine which uses a man made replica of mRNA or messenger RNA to…
Q: 1. What type of mosquito is seen in the picture? 2. How do you think is it connected to systemic…
A: Introduction: Systemic infections are found to be present in the bloodstream. These kinds of…
Q: но- OH он о Но- OH HO HO- OF OH ÓH HO
A: The above given structure represents Stachyose. It is a tetrasaccharide made up of four molecules.…
Q: Molisch Test
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Match these prefixes and suffixes to their meanings. Reset Help -blast The word root means blood.…
A: Medical terms are made up of a combination of the root word, prefixes, and suffixes. Prefixes are…
Q: Please ASAP. Thank you OPTIONS a. Arg-Val-His b. Lys-Val-His c. Pro-Gly-Trp d. Met-Leu-Ser…
A: A codon is a trinucleotide arrangement of DNA/RNA that compares to a particular amino acid The…
Q: ANSWET THESE QUESTIONS Number 6-10 no need to explain just write the correct letter for each number…
A: Quasi-experimental research design: Manipulation of independent variables to observe the effect on…
Q: i want a little story about hepatitis b
A: Liver disorder A medical condition that disturbs the structure and functions of liver is called…
Q: swer it and give me explanation Also.
A: Warfare agents Warfare agents are also called as chemical weapon. It is a specialized materials that…
Q: ter 20 Data Analysis E ch.20 data anaylsis - Google Doc: X…
A: Since you have posted a question with multiple sub-parts, we will solve the first sub-parts for you.…
Q: + + T | + + 1 = + T +||| + 2 +11 + 1 + + 1 + + + 1 + + + + 3 4 5 + + I 9 9 5 U 4 m N 1 + - - + + + +…
A: Given here are point mutattions and the correct order is as follows.
Q: Parents are: CC rr x CCRR F1 are: F2: Fill in the Punnett square: XXX CR Cr cR cr CR CCRR CCR. CCRR…
A: Chi-square (X2) test is a statistical test involves in the calculation of quantity which is used to…
Q: story TIME rition Facts i During this pandemic time, the government does not allow ! senior citizen…
A: Nutrients are molecules and substances that nourish the body for proper growth and development.…
Q: Andrea is flushed and her teeth are chattering even though her bedroom temperature is 72°F. Why do…
A: When a person is flushed it means that the person turns red as they are ill or hot due to a strong…
Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…
A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…
Q: Help me on question 12 14 Just answer don’t explain
A: Excretion is the mechanism by which animals eliminate waste products and nitrogenous metabolic…
Q: - 11 - A A Aa - Verdana AaBbCcl AaBbCc AaBbCcl AaBbCcl AaBbCcl ab Replace A Select- Create and Share…
A: The rate of reaction or reaction rate is the speed at which reactants are converted into…
Q: Bobby has been diagnosed with PKU. His mother wants to know about the treatments. What would you…
A: Phenylketonuria It is an inherited metabolic disorder, characterized by body's inability to utilize…
Q: Seliwanoffs Test
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which 4 organ systems were not pictured on this homework? Pick 4. A. Respiratory B.…
A: All cells arise from pre-existing cells, group of cells together constitute tissues. A collection of…
Q: You are tasked to make an alternative disinfectant for corona virus. Which materials are you going…
A: The coronavirus that causes Covid-19 may exist for certain days on some surfaces. Estimates of its…
Q: es these letters stand for and what do they do? MD, DO, RN,
A: Various abbreviations are used in the healthcare professions. These abbreviations stand for various…
Q: Label the parts of a human eye.
A: The human eye is among the most essential and useful sense organs, and it functions as a natural…
Q: EXPLAIN 2 ways that you could slow the smell from spreading
A: The quetion is all about the horrible smell that could be stopped from spreading throughout…
Q: ive point please What affects our health?
A: Health Wellbeing is a condition of complete physical, mental and social prosperity and not just the…
Q: Second letter UUU UCU UCC UAU UAC UGU Tyr Phe UUCJ UUA UUG. UCA UCC Ser UAA Stop UGA Stop A UAG Stop…
A: 1)Codon on mRNA strand which codes for Methionine is AUG from 5' to 3' direction. This is an…
Q: What are the 4 ways pathogens can enter our bodies? Please type answer
A: Hi, Thanks For Your Question. Answer : Pathogens Are Disease Causing Microbes. These Can Be…
Q: Dermatology - Pronouncing, Spelling, and Dissecting Use the pronunciations to correctly spell the…
A: Introduction Dermatology is a specialty of medicine that focuses on skin conditions and disorders.…
Q: 2. Explain about Stroke culture?
A: Culture media contains all the elements which the bacteria needs for growth and is not selective in…
Q: aа 25-645 aа 1-1210 О аа 645-668 aа 669-1210 O O O
A: The presence of tyrosines and tryptophans near the aqueous interface is a common feature of many…
Q: XM CualtricX Asessm X GWhat sh x O Micrse X 6 Mot- M x translat X JOVSLYaKWzue2 IDENTIFYING HAZARDS…
A: The list of hazards that I can recognise from the above image: Bystanders Cigarette Broken glass…
Q: 1. What are all the possible ways to break the chain of infection, specifically a bacteria or virus…
A: The spread of an infection within a community is described as a “chain,” that consists of several…
Q: I need help to understand mitosis
A: Cell division is a process which involves the division of a mother cell to form two or more daughter…
Q: . Inflammation can be observed among unicellular organisms through electron microscopy. 2.…
A: Inflammation is a protective response involving immune cells, blood vessels, and molecular mediators…
Q: Please i really need the right answer there is mutiple queshtions and i need the right answer and…
A: B is the correct answer. Multiple alleles occur when there are more than two possible alleles for a…
Q: Plz do it quickly questions
A: Anger is an emotional response. Anger is a strong feeling that you have when something has happened…
Q: The . protect the heart and lungs Your answer
A: Introduction:- The thorax, or chest cavity, houses the heart and lungs. The heart is responsible for…
Q: Explain well please
A: Carbohydrates production pathway. Gluconeogenesis is a pathway used by the body to create glucose…
Q: 2 Cyt c 2 Cyt c IM Complex II
A: The electron transport chain is responsible for oxidizing the products of TCA cycle, pyruvate…
Q: NEED HELP i have been given this slide picture of Human lung tissue infected tuberculosis and have…
A: MTB is an obligate human parasite that must protect its host and develop means to escape to new…
Q: You are living through history due to the Covid-19 pandemic and now have real-world experience…
A: COVID-19 is the biggest global event and challenge of our lifetimes, Mostly this pandemic has left…
Q: List down 5 types of hosts and give 1 example each.
A: Host It a organisms either plants or animals where a parasite live and thrive.
Q: A. UTIS without symptoms need not be treated since medication can affect the B. Cranberry juice…
A: Women's health throughout pregnancy, delivery, and the postpartum period is considered to it as…
Q: T7Q यदि AA= 10 एवं aa = 0 है तो अति प्रभाविकता का उदाहरण होगा ? (1) Aa = 5 (2) Aa = 7 (3) Aa = 10…
A: Answer :- जब दो विपर्यासी लक्षणों का आपस में काम कराते है तो, F1 , पीढ़ी में प्रभावी तथा अप्रभावी…
Q: G. Н. I. J. K. L. М. N. (Choose) (Choose) (Choose) IChooco] >
A: Microscope is an instrument which is used to observe objects that are invisible to the naked Eye.…
Q: 14- 13- 12- 11 10- 15 Co 나 16 17 18 19 20 21 -3 1 -2 -5
A:
Q: do in atc 2.- do you come to school? By bus. 3. - is a cup of coffee? 90p. 4. - are you from? I am…
A: 1. What do you do in the evening? 2. How do you come to school? 3. How much is a cup of coffee?
Q: What type of mosquito is seen in the picture? How do you think is it connected to systemic…
A: Vectors are organisms that can spread a pathogen or disease from unknown human host or a human host…
Q: I’m having trouble with a intro cellular respiration and it due today, can someone help he with…
A: Cellular respiration is the cycle through which cells convert sugars into energy. To make ATP and…
Since we are allowed to ask 3 questions each time please answer all thank you!! ANSWER QUESTIONS a,b, and D
Step by step
Solved in 2 steps
- 1 2 3 4 NH2 NH2 NH2 Н-с H-c CH2 H-C H-C N NH2 CH2 H-C N-C CH2 CH2 H \H H/ \H H/ С — С H H H/ OH H но но 6. 7 NH2 NH2 NH2 H-C H-C CH2 H-C H-C CH2 CH2 CH2 NH2 \H H/ H H/ H \H H/ \H H/ H. OH H Он Он н но 6. 10 H-C H-C CH2 NH2 CH2 NH2 ターC \H H/ \H H/ он ОН он он Which of these molecules could be incorporated into primer during DNA replication? Select all that apply: 11. I. 4 IV. V. VI. VII. 8. YII. O =U1) Using the word bank (in letters a-t), match the letters to the sentences below:can someone help me with labeling this :)
- 1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VSequence A: TCT/ TCC/ CTC/ CTA/ AAC/ GTT/ CAA/ CCG/ GTT/ CTT/ AAT/ CCG/ CCG/ CCA/ GGG/ CCC/ CGC/ CCC/ TCA/ GAA/ GTT/ GGT AGA Sequence B: TCA/ GAC/ GTT/ TTT/ GCC/ CCG/ TAA/ CAA/ CTT/ GTT/ ACA/ ACA/ TGG/ TCA/ TAA/ ACG/ TCA/ GAG/ ATG/ GTC/ AAT/ CTC/ TTA/ ATG/ ACT Sequence C: TAT/ ATA/ CAT/ GTA/ AAC/ ACA/ TAC / TCA/ GTG/ GAC/ CAA/ CTC/ AAC/ ATA/ AAC/ CAA/ ACA/ CCG/ CTC/GCG/ CCG/ AAA/ AAG/ ATA/ TGG STEP 1: Transcribe each of the 3 DNA sections into nRNA. Write out the complementary CODONS directly below the DNA strands. STEP 2: Clearly identify the three fragments as the FIRST, SECOND and THIRD fragments by clearly labeling any obvious PROMOTERS, START and STOP codons. STEP 3: Number the the START codon #1 and number the codons in the correct order until the STOP codon is reached. STEP 4: Codons 14- 64 (including 14 & 64) represent an intron. Draw a single red line through these codons to indicate that they will NOT be translated. STEP 4: In the space provided, write out the…w6 apply answer letter b
- HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)Based on the image below, select the correct statement. Complex II QH₂ Q- 10 2 HO 2 HO Fe-S (2.8 FADH₂ FAD- Succinate Fumarate https://canvas.uts.edu.au/assessment questions/356986/files/1562694/download? 2e verifier-eUTT3hYal2YYTWlywV8TIFA3USmzCsM52jECmvTo O Succinate is reduced to fumarate O Succinate is oxidised to FAD O The Fe-S center shuffles electrons from FAD to ubiquinone (Q) O The Fe-S center shuffles electrons from FADH2 to ubiquinone (Q) The Fe-S center shuffles electrons from FADH2 to ubiquinonol (QH2) W 88 16°Cidentify 15 unique medical terms. Identify the prefix, word root, and suffix for each medical term. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4322016/