Homework Help is Here – Start Your Trial Now!
Science
Biology
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG. TGACCATGAAACTCACACCGGGGCGCACTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: TAGTGGTACGGCC b. Using this DNA double helix, express the gene - i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. When you type in the answer Do NOT put spaces between the amino acids - e.g. MetThrLys... When you get to a stop codon - you may type in an asterisk - **u polypeptide sequence: AUCACC met, pro,: c. Does the sense strand DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below using CAPS LOCK and NO SPACES - e.g. ATGCCGAG. 5'UTR = AUCACC 3'UTR = UAUAACACAUUU UUU UUC UUA UCU UCC UCA UCG UAU UAC UAA UAG UGUT UGC UGA Phe Tyr Cys Ser Stop Leu UUG Stop UGG Trp CU CUU CUC CUA CUG CGU Y CGC CGA CGG CAUY His CAC Leu Pro Arg CA CcG) CAA Gin CAG} AGU AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA Asn Ser AGC J AGA Arg AGG le Thr Met AAG Lys GGU GGC GUU GUC GUA GUG. GCU GCC GCA GCG GAU Asp GAC GAA Glu Val Ala Gly GGA GGG , GAG

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG. TGACCATGAAACTCACACCGGGGCGCACTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: TAGTGGTACGGCC b. Using this DNA double helix, express the gene - i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. When you type in the answer Do NOT put spaces between the amino acids - e.g. MetThrLys... When you get to a stop codon - you may type in an asterisk - **u polypeptide sequence: AUCACC met, pro,: c. Does the sense strand DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below using CAPS LOCK and NO SPACES - e.g. ATGCCGAG. 5'UTR = AUCACC 3'UTR = UAUAACACAUUU UUU UUC UUA UCU UCC UCA UCG UAU UAC UAA UAG UGUT UGC UGA Phe Tyr Cys Ser Stop Leu UUG Stop UGG Trp CU CUU CUC CUA CUG CGU Y CGC CGA CGG CAUY His CAC Leu Pro Arg CA CcG) CAA Gin CAG} AGU AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA Asn Ser AGC J AGA Arg AGG le Thr Met AAG Lys GGU GGC GUU GUC GUA GUG. GCU GCC GCA GCG GAU Asp GAC GAA Glu Val Ala Gly GGA GGG , GAG

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

I need help answering the quehstions 

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG. TGACCATGAAACTCACACCGGGGCGCACTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: TAGTGGTACGGCC b. Using this DNA double helix, express the gene - i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. When you type in the answer Do NOT put spaces between the amino acids - e.g. MetThrLys... When you get to a stop codon - you may type in an asterisk - "** polypeptide sequence: AUCACC met, pro,: c. Does the sense strand DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below using CAPS LOCK and NO SPACES - e.g. ATGCCGAG. 5'UTR = AUCACC 3'UTR = UAUAACACAUUU UUU UUC UUA UCU UCC UCA UCG UAU UAC UAA UAG UGU UGC UGA UGG Phe Tyr Cys Ser Stop Leu UUG Stop Trp CU CUU CUC CUA CUG CGU Y CGC CGA CGG CAUY His CAC Leu Pro Arg CA CcG) CAA Gin CAG} AGU AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA Asn Ser AGC J AGA Arg AGG le Thr Met AAG Lys GGU GGC GUU GUC GUA GUG. GCU GCC GCA GCG GAU Asp GAC GAA Glu Val Ala Gly GGA GGG , GAG
Transcribed Image Text:a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG. TGACCATGAAACTCACACCGGGGCGCACTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: TAGTGGTACGGCC b. Using this DNA double helix, express the gene - i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. When you type in the answer Do NOT put spaces between the amino acids - e.g. MetThrLys... When you get to a stop codon - you may type in an asterisk - "** polypeptide sequence: AUCACC met, pro,: c. Does the sense strand DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below using CAPS LOCK and NO SPACES - e.g. ATGCCGAG. 5'UTR = AUCACC 3'UTR = UAUAACACAUUU UUU UUC UUA UCU UCC UCA UCG UAU UAC UAA UAG UGU UGC UGA UGG Phe Tyr Cys Ser Stop Leu UUG Stop Trp CU CUU CUC CUA CUG CGU Y CGC CGA CGG CAUY His CAC Leu Pro Arg CA CcG) CAA Gin CAG} AGU AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA Asn Ser AGC J AGA Arg AGG le Thr Met AAG Lys GGU GGC GUU GUC GUA GUG. GCU GCC GCA GCG GAU Asp GAC GAA Glu Val Ala Gly GGA GGG , GAG
Expert Solution
steps

Step by step

Solved in 4 steps with 2 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Serology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS