Answered: a. Write the structural formula of GAC,… | bartleby

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 5P

See similar textbooks

Related questions

Question

Practice Pack

ACTIVITY 7.2.3
Ja. Write the structural formula of GAC, a portion of DNA. Write
the complementary strand adjacent to it so that the
complementary bases are side by side. Connect the
appropriate base pairs.
b. Sticking to the convention of writing the nucleotide sequence
in the 5'-3' direction, what is the nucleotide sequence of the
DNA strand complementary to ATGCACCATGCT?

Expert Solution

Learn your way

Includes step-by-step video

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Blurred answer

Similar questions

Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?
a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 5
.. CTGATTCCGAA TG5 ACTIVITY 7.3.1 Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. .GACTAAGGCTTAG . CTGATICCGAATGS 5'... NEW STRANDS (Fill in the correct bases and supply arrowheads.)
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedure
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
8:47 ll 5G% 4 Chapter 9 DNA worksheet 2022.d... 2. Write the mRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5') 3. Refer to the codon chart at the bottom of the page. Translate the mRNA into a polypeptide using the following rules. (2 points) Direction of translation of mRNA is from 5' to 3'. 1. MRNA codons are read in groups of three nucleotides. 3. Translation must begin at the START codon. 4. the STOP codon terminates translation. 2. THIRD LETTER SECOND LETTER U TulUUU Phe UUC Phe UUA Leu UUG Leu A UGU Cys U JUGC Cys C UCU Ser UAU Tyr UCC Ser UAC Tyr UCA Ser UAA STOP UGA STOPA UCG Ser UAG STOPUGG Tp G CCUU Leu CÚC Leu CỦA Leu CUG Leu AJAUU Ile AUC Ile AUA Ile AUG Met STARTACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val CCU Pro CAU His CCC Pro CAC His CCA Pro CAA Gln CCG Pro CAG Gln ACU ThrAAU Asn AGU…
Compare and contrast the structure of DNA and RNA. Be sure to describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components. In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.
2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).
A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in
A. Draw a detailed structure of DNA strand using the following sequence of bases 5'A -C- G 3' Show the structure of the phosphate group, pentose sugar and nitrogen containing base B. Why is DNA called the blueprint of an organism?
Please explain it simply, and don't over-explain. Thanks! A. How is DNA structure arranged to allow it to do its function?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Anatomy & Physiology

Biology

ISBN:

9781938168130

Author:

Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:

OpenStax College

Biochemistry

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Anatomy & Physiology

Biology

ISBN:

9781938168130

Author:

Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:

OpenStax College

SEE MORE TEXTBOOKS