What is the isoelectric point of the following peptide molecule? Asp-His-Glu-Gly-Lys-Tyr-Leu-Phe-Arg-Ser-Cys Relevant pKa values are; 2.2, 3.8, 4.3, 6.0, 8.3, 9.8, 10.1, 10.5, 12.5 and 13.1 3.0 9.1 7.2 5.2 4.1 ONLY one correct answer

What is the isoelectric point of the following peptide molecule? Asp-His-Glu-Gly-Lys-Tyr-Leu-Phe-Arg-Ser-Cys Relevant pKa values are; 2.2, 3.8, 4.3, 6.0, 8.3, 9.8, 10.1, 10.5, 12.5 and 13.1 3.0 9.1 7.2 5.2 4.1 ONLY one correct answer

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: (a) Estimate the Km and Vmax for the wild-type and mutant enzyme from the graph. (b) Calculate the…

A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…

A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…

Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…

A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…

Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…

A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…

Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…

A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…

Q: true/false: N-acetyl glutamate regulates the urea cycle by increasing the transcription of the…

A: Urea cycle is an important catabolic pathway in which ammonia is removed from the body in the form…

Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…

A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…

Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…

A: An apurinic/apyrimidinic site or abasic site can be created as a result of DNA damage or as a part…

Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…

Q: QUESTION: Which of the following statements about Carbohydrates is TRUE? O The human body can…

A: Carbohydrates are one of the important biomolecules. These are also termed as hydrates of carbon.…

Q: describe the functions of the pentose phosphate pathway. Explain how NADPH functions in biosynthesis…

A: In a cell, glucose 6-phosphate has two possible fates: be oxidised into carbon dioxide and water by…

Q: Base Adenine Guanine Cytosine Thymine Type of Bases Ring structure Number of hydrogen bonds…

A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) DNA has a…

Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.

A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…

Q: Determine whether each of the examples or phrases describes an essential amino acid, a nonessential…

A: INTRODUCTION: They are the building blocks of proteins and amino Group (NH2) and Carboxyl Group…

Q: Fill up the table below. For inferences, indicate the identity of the macronutrient being tested in…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: ОН ОН ОН tautomerization

A: Tautomerization is the process by which structural isomers interconvert between each other. The…

Q: Structure, localization and biological significance of glycogen.

A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…

Q: Which of the following molecular formulas would be for an aldopentose? C4H8O4 C₂H₁408 C6H12O6…

Q: What statement is true regarding LDL? Because the LDL is plasma lipoproteins with a lipid bilayer,…

A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…

Q: Which major biosynthetic pathways utilize PRPP? de novo purine synthesis lysine biosynthesis…

A: INTRODUCTION: De novo purine synthesis- it is the synthesis of complex molecules from simple…

Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Please explain this table (just the endothelial cell density)

A: Endothelial cells are a single layer of cells that lines all the blood vessels, lymph cells,…

Q: The substitution of His 64 of carbonic anhydrase II with Ala results in a sharp decrease in the…

A: Carbonic anhydrase II is the enzyme that catalyzes the formation of H2CO3 from CO2 and H2O, and…

Q: A cyclic AMP (CAMP) binding protein was isolated from mammalian cells and characterized by…

A: Given that,The ligand is cAMPThe receptor is cAMP binding protein (CBP)also the concentration of CBP…

Q: Which of the following correctly illustrates a dipeptide and an amino acid in the optimal position…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: What happens to the double helix when the bases pair in non complementary ways, for example a G-T…

A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…

Q: Which reaction below in the glycolytic pathway has a highly unfavorable delta Gº¹ but a favorable…

A: Free energy changes: The Gibbs free energy is used to calculate the maximum amount of work that a…

Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…

A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…

Q: The primary purpose of the aconitase step in Citric Acid Cycle is to: form the intermediate…

A: The citric acid cycle involves acetyl-CoA oxidation into carbon dioxide and water. The acetyl-CoA…

Q: a) What structural aspect of these 18-carbon fatty acids can be correlated with the melting point?…

A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…

Q: Which of the following interactions would be seen between the R-groups of His and Gln at pH 8?…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Show a calculation of change in standard reduction potential that explains why succinate is not…

A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…

Q: You are interested in cloning a gene that codes for an enzyme that produces a blue pigment. You have…

A: Introduction pUC19 is plasmid vector. Plasmid is a cloning vehicle used in recombinant DNA…

Q: Which enzyme activity would be inhibited if fluorodeoxyuridine-5 monophosphate is present?…

A: The compound fluorodeoxyuridine 5’-monophosphate (FdUMP) is a compound that has similar structure to…

Q: 2. What is the terms used to describe what is happening to the members of the electron transport…

A: Electron transport system occurs in the inner mitochondrial membrane. This system causes a series of…

Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…

A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.

Q: An equilibrium dialysis study was carried out with a ligand binding receptor protein. The protein…

A: Scatchard plot is a very useful plot to determine the affinity of association of ligand and a…

Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…

A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…

Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…

Q: Which of the following is true of the molecule below?

A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…

Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…

A: Lipids are compounds which are soluble in organic solvents and insoluble in polar solvents, i.e.,…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: A total of 7.21 g of dry mixture with a protein content of 89.2% (w/w) determined by Kjeldahl…

A: % w/w tells us the grams of analyte in 100g of mixture. Hence, a protein content of 89.2% (w/w)…

Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…

A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…

Q: When studying the mechanism of the enzymatic reaction, functional groups were found that ensure the…

A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…

Q: Which two statements below accurately describe the roles of insulin and glucagon in maintaining…

A: Glucagon is a hormone secreted by the pancreas that controls the blood glucose level. It prevents…

Q: Explain why the combined presence of polyphenol oxidase and iron greatly increase the instability of…

A: Introduction Fatty acid is one of the macromolecule present in our body. Fats and oils are composed…

Q: Hormones and other signaling molecules: definition. Classification of hormones by chemical…

A: Hormones are chemical substance that are produced by endocrine glands. While paracrine signaling…

Question

What is the isoelectric point of the following peptide molecule?

Asp-His-Glu-Gly-Lys-Tyr-Leu-Phe-Arg-Ser-Cys

Relevant pKa values are; 2.2, 3.8, 4.3, 6.0, 8.3, 9.8, 10.1, 10.5, 12.5 and 13.1

3.0

9.1

7.2

5.2

4.1

ONLY one correct answer

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction: -

VIEW

Step 2 Explanation: -

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

The tripeptide +H3N-Leu-His-Glu-COO- has pKa values of 2.2, 3.6, 6.0 and 9.1. The isoelectric point (pI) for this peptide will be: 8 5 6 4 None of the above
What products are formed when each peptide is treated with trypsin? Be sure to answer all parts. [1] Phe-Leu-Phe-Asn-Lys-Ser [2] Phe-Ser-Thr-Arg-His-Trp [3] Met-Met-Lys-Val-Asp-His-Thr-Thr-Tyr-Ala-Thr-Glu
H CH₂ H₂C HC-CH3 CH₂ H H₂C (S) H₂C H CH₂ CH₂ CH₂ NH O C NH NH₂ a) Which of the following statements about this peptide are correct? Group of answer choices Treatment of this peptide with trypsin generates two products. This peptide is a substrate for carboxypeptidase A Treatment of this peptide with cyanogen bromide generates a pentapeptide and a tripeptide. Treatment of this peptide with chymotrypsin generates three products. Treatment of this peptide with elastase generates 2 products. None of the above statements are correct. b) What is the sequence of this peptide using one letter abbreviations? c) What is the pH which would correspond to the ionization of the peptide as drawn above? 1, 5, 7, 10, 14
The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to control pain, is shown here: Tyr-Gly-Gly-Phe-Met-Thr-Ser-Glu-Lys-Ser-Gln-Thr-Pro-Leu-Val-Thr- Leu-Phe-Lys-Asn-Ala-Ile-Ile-Lys-Asn-Ala-Tyr-Lys-Lys-Gly-Glu What fragments are obtained as a result of treatment withcyanogen bromide?
The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to control pain, is shown here: Tyr-Gly-Gly-Phe-Met-Thr-Ser-Glu-Lys-Ser-Gln-Thr-Pro-Leu-Val-Thr- Leu-Phe-Lys-Asn-Ala-Ile-Ile-Lys-Asn-Ala-Tyr-Lys-Lys-Gly-Glu What fragments are obtained as a result of treatment with trypsin?
After the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin. (After a polypeptide is treated with maleic anhydride, trypsin will cleave the polypeptide only on the C-side of arginine.) Gly-Ala-Asp-Ala-Leu-Pro-Gly-Ile-Leu-Val-Arg-Asp-Val-Gly-Lys-Val-Glu-Val-Phe-Glu-Ala-Gly-Arg-Ala-Glu-Phe-Lys-Glu-Pro-Arg-Leu-Val-Met-Lys-Val-Glu-Gly-Arg-Pro-Val-Gly-Ala-Gly-Leu-Trp In what order will the fragments be eluted from an anion-exchange column using a buffer of pH = 5?
The following sequence of amino acids are part of adult hemoglobin from the N-terminus. Draw the skeletal structure of this peptide. Val-His-Leu-Thr-Pro-Glu-Glu-Lys-Ser-Ala-Val-Thr
Porcine dynorphin is a neuropeptide having 17 amino acid residues. Its structure is shown below. Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln 8. How does trypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C-terminal end. 9. List down the different fragments that would result if dynorphin were cleaved by trypsin. 10. How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. 11. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin. 12. Cyanogen bromide is a chemical reagent which also cleaves peptide bonds.…
An oligopeptide has the following amino acid sequence: NH2-Ala-Glu–Leu–Trp–Tyr-Ser–Gly–Lys–Leu-Ala–Arg-Ala-Phe-Ile-Pro–Gly-COOH a) Estimate the net electric charge of the molecule at pH 8.0 and pH 11.0. b) If the above peptide is passed through a cation exchange chromatographic column (that is, the matrix of the column has negative charges) stabilized at pH 8.0, would you expect it to be retained on the column? c) Indicates the number of fragments, and the sequence of each of them, that would be obtained when treating the peptide in question with: i) trypsin, ii) chymotrypsin.
A tetrapeptide, glutamate-glycine-alanine-lysine, is prepared at at concentration of 1 mM (0.001 M) and is measured in the standard setup (pathlength of 1 cm). What is the approximate absorbance of this peptide at 280 nm? Hint: if the peptide contained a single tryptophan, the answer would be about 10. 10 280 1 0
Consider the peptides Pro-Gin-Val-Phe-His-Asp-Cys and His-Gln-Pro-Cys-Asp-Phe-Val. How do these two peptides differ? (Select all that apply.) The two peptides have different compositions. The two peptides have different isoelectric points. The two peptides have different titration curves. The two peptides differ in amino acid sequence. [References] If you were to have a mythical amino acid based on glutamic acid, but one in which the hydrogen that is attached to the y-carbon were replaced by another amino group, what would be the predominant form of this amino acid at pH 12 if the pK, value were 10 for the unique amino group? (Select all that apply.) Both of the carboxyl groups are deprotonated. The amino acid-carries a negative 2 charge. The amino acid carries a negative 4 charge. The amino groups are in the form -NH". Both of the amino groups are deprotonated.
Consider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helix