comparison of the worms' body structures:

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: Penicillin G is an antibiotic that is used to treat bacterial infections. Pneumonia, strep throat,…

Q: economic and ecological significance of Rye (Secale)

A:

Q: Viruses with reverse transcriptase enzyme can make a DNA copy out of its RNA genome.  What…

A: Reverse transcriptase (RT) It is an enzyme through a single-stranded RNA transcribes into the DNA.…

Q: Answer the two parts of the question. a) Explain what gene therapy involves. b) Discuss how gene…

A: Gene therapy presents one of the best technical difficulties in current medicine. It is…

Q: A farmer wants to breed a variety of taller corn. a) How can the farmer use variation in the height…

A: Introduction Selective breeding involves pairing up parents with similar characteristics in order to…

Q: In certain regions, monk seals overturn rocks to catch prey underneath. But nearby sharks often…

A: Introduction Ecological interactions:- It is the relationship between two different or the same…

Q: In cichlid fish, GNRH becomes increasingly active in the brain cells of: O A dull color fish O A…

A: The conventional hypophysiotropic GnRH system (now referred to as GnRH1), which expresses gnrh1 gene…

Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…

A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…

Q: Summarize how the virus interacts with the cells in the airway and lungs and is related to disease…

A: ICTV announced severe acute respiratory syndrome coronavirus 2 SARS-CoV-2 as the name of the new…

Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…

A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…

Q: Primase has the important role of removing the RNA primers and filling the gaps with new DNA…

A: DNA replication There are number of processes necessary for the continuation of generation, growth…

Q: 9. Suppose you accidentally introduce a small plant-eating beetle into your self-contained…

A: You construct a self-contained ecosystem in a jar, following some instructions. Your ecosystem…

Q: You are working with a bacterial lysogen and have decided to induce lysis. What needs to happen for…

A: Viruses are an obligate intracellular parasites. Some viruses are temperate phages that have to…

Q: The bacterium Clostridium difficile (sometimes abbreviated C. diff) is a gut bacterium that can…

A: The clostridium bacterium is found in  colon which is the reason of many colon or digestive tract…

Q: What would happen to a person whose body did not produce bile ?

A: Bile is the fluid which is synthesized and secreted by liver and stored in the gallbladder.  Main…

Q: Some types of hormones regulate appetite. Which the hormones trigger the feeling of hunger and which…

A: The hormone which majorly triggers the feeling of hunger is Ghrelin. It is also known as the “hunger…

Q: Enumerate primary organ rudiments that have started to take form in the 24 – hour chick embryo…

A: Introduction A multicellular organism's embryo is the first stage of development. Embryonic…

Q: If thymine makes up 23% of the bases in a specific DNA molecule, what percent of the bases are…

A: INTRODUCTION Deoxyribonucleic acid (DNA) is a molecule that conveys genetic information necessary…

Q: Can (1) chain and (2) ring structural abberations still lead to fertile gametes? explain

A: Abberations indicates the genetic material which should be DNA . The DNA transfer the information…

Q: Describe the key characteristics that would allow you to identify or differentiate diatoms, green…

A: A microorganism that can only be seen under a microscope. Bacteria, fungi, algae, and protozoa are…

Q: A heart microslide demonstrates cells in the shape of pale chords, which have few myofibrilla,…

A: 2. ANSWER;- Contractile cells, Purkinje's fibers Explain;- Contractile cells conduct impulses and…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…

A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…

Q: which of these is characteristic of gram positive, gram negative bacteria or mycobacteria have a…

A: Bacteria are microscopic prokaryotic ubiquitous organism which do not have nucleus nor membrane…

Q: both complex I and complex II send electrons to cytochrome c, how many cytochrome c molecules will…

A: Electrons from Nadh pass through a flavoprotein to a series of iron sulphur proteins in complex I to…

Q: Statements: I. Thymosin acts to prevent rate of actin polymerization. II. Loss of tight junction…

A: This question is about cells.

Q: This process involves plastocyanin.

A:

Q: Certain cells in the retina respond differently to the direction in which objects move. To…

A: A retinal ganglion cell (RGC) :- is a kind of neuron which is found near the inner surface of the…

Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…

A: The answer is to store your phage long term so that anyone who accesses the phage database could…

Q: Describe the process of DNA replication of the leading strand?

A: ANSWER;-

Q: In the 33 hr. chick embryo stage what structure/s would serve as a guide to approximately…

A: Auditory vesicles are distinct. Three pairs of arterial arches arise from the ventral aorta. Somites…

Q: You were tasked to check the quality of your E.coli stock from your -80 °C freezer. This isolate…

A: To check the quality of the E.coli stock, we need to send the duplicates to three different…

Q: Which option is a nonrenewable source of energy Petroleum Sunlight Water Wind

A: We used energy from our environment to do verious work. For light, heat, current, industry we used…

Q: What are the physiological changes that can occur when an individual adds resistance training to…

A: Introduction Resistance training is any exercise that causes the muscles to contract against an…

Q: Insects are capable of fairly advanced behavior. e and briefly explain an example of advanced insect…

A: Insects are invertebrates belonging to the phylum Arthropoda and class Insecta. they are the largest…

Q: AN

A: Male toad

Q: Which nitrogen base is found in RNA but not in DNA? Multiple Choice adenine thymine cytosine uracil…

A: ANSWER) (d) Uracil In RNA instead of Thymine there is Uracil which bind with the Adenine with the…

Q: Lungfishes Amphibians Mammals Amnion Lizards and snakes Crocodiles Ostriches Feathers Hawks and…

A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…

Q: SARS-CoV-2 spreads through cell-to-cell transmission

A: Introduction Covid 19 is a coronavirus-caused acute respiratory infection in humans that can cause…

Q: The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which…

A: Superoxide is composed of highly reactive oxygen atoms. It has the ability to reduce metal ions and…

Q: CONCENTRATION (NG/ ML) ABSORBANCE 655 NM (AU) 0.695 0.699 1000 500 250 0.587 125 0.513 63 0.385 31…

A: ELISA stands for enzyme-linked immunosorbent assay. It is a commonly used bio-chemical assay, that…

Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…

A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…

Q: 12. There are different types of symblotic relationships between different specles. Match the type…

A: Introduction Ecology is the study of the environment, and it helps us understand how species…

Q: The students of a Microbiology class were tasked to transfer or subculture a pure culture of…

A:

Q: If you cloned GFP under the control of the V. fischeri Lux promoter, when would you see GFP…

A: Vibrio fischeri exhibits bioluminescence only when the density of its cell is higher and…

Q: what type of selection is this trait likely experiencing in this population?

A:

Q: retort pouch is: a) Filled first with food product and then retorted (heat-sterilization) to extend…

A: In retort pouch food is filled into a pouch . Then it sealed and next heated to extremely high…

Q: Answer the following questions about this phylogenetic tree. What animal represents the out group in…

A: According to bartleby guidelines, only the first three subparts have been answered. Kindly post the…

Q: In most populations, population size remain near the carrying capacity as long as limiting factors…

A: Limiting resources are considered as the carrying capacity for any population.

Classification of Marine Organisms

Classification is a way of categorizing organisms that enables an easy process of identification of such organisms. All living things are classified by grouping them under specific categories. The grouping is done based on the close relativeness of the organisms. The classification tool requires knowledge of characteristics, differences, and similarities between different organisms.