Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B 3 C- TT 4 D You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G H I J K L

Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B 3 C- TT 4 D You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G H I J K L

Name: Consider the following simple regulatory pathways. Assume the full pa
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Consider the following simple regulatory pathways. Assume the full pathway is shown.A-E-B-F-C-G-D-1 AH-2 B|| LYou identify several null mutations (a complete deletion of the gene). For each mutant (indicatedwith a - sign), determine whether the fina

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > I > J K
Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >
The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three structural genes, lacZ, lacY and lacA. Which structural genes are involved in lactose metabolism? Explain. (ii) Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote. (iii) What is the function of the promoter in the bacterial operon?
Consider the following 4 regulatory pathways (recall arrows are activators and blunt ends are inhibitors). 01 2 3 1 A- 4 2 B- 3 C- 4 D E F G H T1 I Which of the following pathways would result in the final gene (I, J, K or L) being activated by the presence of the first gene (A, B, C, or D)? Select all that apply. J K L
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Y
O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
CTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mamma- lian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbal- anced nucleotide pools, and they have an elevated spontaneous mutation rate. Explain the likely basis for these observations.
Consider the mechanism of the enzyme RNase:  What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain.  What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.
Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?
Each type of molecule listed below is recognized by a specific class of nuclear import receptor (importin) or nuclear export receptor (exportin). For each type of molecule, state whether you think it is recognized by an importin or exportin and explain why (in terms of where that molecule is synthesized, what that molecule does, and where it does it). (a) RNA polyermase II: (b) ribosomal protein: (iii) †RNA:
Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved