Create a function called oddLessEven that takes a positive integer input and returns the sum of the odd and even digits subtracted. For instance, the oddLessEven software. (Submit a single C++ file including your oddLessEven function and the main function.) main() int cout oddLesseven(23) endl; // prints 1; // prints -2; // prints 21 return 0; cout oddLessEven(777); // prints 23;
Q: Explain the dangers of each authentication technique and provide a solution to the following…
A: Using hashed passwords for authentication can help protect against password theft or unauthorized…
Q: What exactly is meant by the term "online analytical processing" (OLAP), and how is it used in…
A: - We need to talk about online analytical processing" (OLAP), and how is it used in practise
Q: Data storage and visualization. Explain how you would utilise each BI component in combination with…
A: What is data warehouse: A data warehouse is a centralized repository that is designed for storing…
Q: What task does the DBMS driver carry out?
A: A DBMS driver is a software component that enables communication between the database management…
Q: Given an 8-word, direct mapped cache, and the sequence of address accesses below, enter the number…
A: Given an 8- word direct mapped cache and a sequence of memory address accesses which is…
Q: A portion of the main program to call a subroutine SUB in an 8085 environment is given below. : :…
A: To return control to LP+DISP+3 when the RET instruction is executed in the subroutine, the return…
Q: Classes are scheduled at a school. Once students have submitted their course requests, a computer…
A: In this question we have to understand and identify the guiding concept that is represented in the…
Q: Do you recommend using MongoDB or Neo4J for the CEO?
A: We cannot make specific recommendations for individual CEOs or companies as the choice between…
Q: What is the best way to track the information requests?
A: Answer is given below
Q: Manufacturers and distributors beg you to stock their new items as the chief buyer for a big grocery…
A: In today's fast-paced and competitive retail environment, grocery chains are constantly faced with…
Q: Laws define security standards, while ethics give direction on what is ethically acceptable to…
A: 1. Information security is the measures taken to care for digital information from unauthorized…
Q: Calculate the performance of addFirst, remove(Object), and removeLast for each of the three…
A: The performance of addFirst, remove(Object), and removeLast operations can vary for different…
Q: Where do you see the scales tipping in DFDs?
A: Data flow diagram depicts the way data is processed by a system, the inputs and outputs with a…
Q: Identify the various kinds of data management technologies that use methodologies other than SQL…
A: Dear learner, hope you are doing well, I will try my best to answer this question. Thank You!!
Q: When a word's initial letter is highlighted in vim, you may capitalize it by entering x followed by…
A: The text editor with the abbreviation "vim" or "vim" is favoured by computer programmers due to its…
Q: Insufficient Overlapping Subproblems and the Principle of Optimality (Optimal Substructure) are both…
A: In this question we have to understand and discuss the concepts of "Insufficient Overlapping…
Q: Justify your position on whether or not you find the following to be an infringement of copyrights…
A: Understanding and respecting copyright laws are essential for creators, users, and distributors of…
Q: What distinguishes a secondary index from a clustering index?
A: Database indexes that are used to accelerate query processes include clustering indexes and…
Q: What are the many kinds of network layer services?
A: Network layer: The network layer is one of the seven layers in the OSI (Open Systems…
Q: What impact does data mining have on security and personal privacy?
A: Data mining is typically used to extract knowledge from large datasets that may be too complex for…
Q: Let M represent a particular relation R on the set A in the form of a matrix. Assume set A has n…
A: Answer is given below
Q: Invisible web: what is it and how big is it?
A: The invisible web, also known as the deep web or hidden web, refers to the vast amount of content on…
Q: how to build a daycare business layout of your wired network (Packet Tracer)?
A: To build a functional wired network for a daycare business, it is necessary to plan, design, and…
Q: Which three responsibilities do you think a database administrator must take on above all others?…
A: Database Administrator (DBA): A person responsible for managing and maintaining a database system,…
Q: Please outline the normal duties associated with the design and execution services provided by the…
A: The personnel that make sure everything with databases is operating correctly are called database…
Q: still getting the same error that librosa does not have module lfcc even after librosa upgrade.…
A: Implementation of the program, assuming you have a directory containing WAV audio files and have…
Q: In the field below, enter the integer value of the $v0 register after executing the following…
A: Given $zero=0 , $at=44 . We have to find the integer value of the $vo register after executing the…
Q: You have multiple local administrators. These users are modifying security-related policies. You…
A: Dear learner, hope you are doing well, I will try my best to answer this question. Thank You!!
Q: stablish that this problem is NP-complete. Both S and t are whole numbers. Can we t-sum a subset…
A: The Subset Sum problem is the name for the issue you've just explained. Determine whether there is a…
Q: What is architecture so crucial? Imagine mapping a project both with and without architecture. the…
A: Software Architecture Theater a crucial role in the development process of any software project.…
Q: Please provide more detail on the following four key benefits of using continuous event simulation.
A: Continuous event simulation allows organizations to model complex systems and processes and evaluate…
Q: Give an explanation of and contrast between wireless communication, coaxial cable, fiber-optic…
A: Wireless communication, coaxial cable, fiber-optic cable, and twisted-pair cable are all different…
Q: Your corporate customer base has slowed. Some long-term workers are discouraged, but you think…
A: The full form of SWOT is Strengths, Weaknesses, Opportunities, and Threats. The SWOT analysis is…
Q: Can you explain the function of the DBMS driver?
A: A DBMS (Database Management System) driver is a software component that acts as a mediator between…
Q: Describe the role that data independence plays in the ANSI SPARC architecture.
A: In the field of computer science, data independence is a crucial concept that pertains to the…
Q: Prove that the next issue is in the NP class: An integer t and a collection of integers S have…
A: The two requirements of the NP class must be demonstrated in order to demonstrate that the issue of…
Q: According to you, what do you consider to be the three most important tasks of a database…
A: The three most important tasks of a database administrator are ensuring the security of the…
Q: The Problem: You've working on a bunch of code you're not familiar with and wish to go through the…
A: Introduction: In this condition, we need to do is find the function definition in your code base.…
Q: What are the top three most significant responsibilities of a database administrator? How can we…
A: A database administrator (DBA) is a professional responsible for managing and maintaining the…
Q: Mel spectrogram is different from LSF. I want a code to extract LSF, not mel spectrogram
A: Python is an object-oriented, high-level programming language computer programming language used to…
Q: SQL;2008 has several new built-in functions. Just list the four (4) uses, please.
A: SQL:2008 introduced several new built-in functions; here are the four lists below.
Q: Write an assembly language program which read a string and print it in uppercase. This program…
A: Below code is written in x86 Assembly language. The program starts by displaying a prompt to the…
Q: What about the individual trees for each question?
A: What is tree: In logic and mathematics, a tree is a graphical representation used to show the…
Q: For this part, Dim motors() As Motor ReDim motors(10) Dim newMotor As Motor newMotor.MotorId =…
A: It is not a new class form-: Public Class Motor Public Property MotorId As String Public…
Q: In the context of Big Data and the Cloud, what exactly is a Distributed Lock Service?
A: A Distributed Lock Service is a system that enables coordination between manifold process or nodes…
Q: A Windows 10 administrator needs to send messages to other users on an Active Directory network.…
A: When a Windows 10 system administrator encounters a authorization issue, it usually revenue with the…
Q: What would you do during the Implementation phase of an Information System you helped design for a…
A: The implementation phase of an information system refers to the process of installing and…
Q: I want a Python code to loop through audio files and extract Line spectral frequencies (LSF) and…
A: In this question we have to write a python code which loop through audio files and extract Line…
Q: 3 1 2 A compiler produces a program with the following mix of instructions: Instruction Class 1 2…
A: In computer science, performance analysis is an important aspect of designing and optimizing…
Q: What do we mean when we talk about embedded systems? Explain the many functions served by the…
A: A computer system is an electronic device or set of devices that can perform various tasks by…
Create a function called oddLessEven that takes a positive integer input and returns the sum of the odd and even digits subtracted. For instance, the oddLessEven software. (Submit a single C++ file including your oddLessEven function and the main function.) main() int cout oddLesseven(23) endl; // prints 1; // prints -2; // prints 21 return 0; cout oddLessEven(777); // prints 23;
Step by step
Solved in 4 steps with 2 images
- Any help would be greatly appreciated!! If you could attached screenshots of the code that would be very helpful!! Write code for the following: Write Python code that uses a loop to prompt the user for five floating point numbers and reports the sum of the floats when the loop ends. Write Python code that defines a void function named divide that takes two numbers as parameters and then prints the quotient accurate to 1 decimal place when the first parameter is divided by the second one. A file named txt is shown on the right. Write Python code that opens this file, reads only the first two lines, and prints “Penny is 19” Penny 19 Kenny 20 Benny 21 Jenny 202. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…// In python // def compute_stats():"""Write a function compute_stats, such that given a string of grades as an input parameter,it calls the function get_new_grades (defined in theprevious question) and returns a tuple that containsthe average value of the initial grades andthe average value after running the get_new_grades function.""" pass
- C Programming Problem : Write a C program with a function that takes an integer value (1 <- integer value < 9999) and returns the number with its digits reversed. For example, given the number 6798, the function should return 8976. Those two- original number and reversed number- numbers will pass to another function as parameters and calculate their sum. The program should use the function reverseDigits to reverse the digits and SumOriginalReverse to calculate their sum. Your output should appear in the following format: Output reverse digiS 4321 Main Enter a number between 1 and 9999: 6798 The number with its digits reversed is: 8976 6798 + 8976 - 15774 12.34 JomoriginalRevers Enter a number between I and 9999: 6655 The number with its digits reversed is: 5566 6655 + 5566 = 12221 Enter a number between 1 and 9999: 8 The number with its digits reversed is: 8 8 + 8 = 16 Enter a number between 1 and 9999: 123 The number with its digits reversed is: 321 123 + 321 = 444 Enter a number…Create a program using C++ that satisfies the following requirements: SAMPLE ATTACHED Develop a function called "randomPairsGenerator" that generates and displays pairs of random numbers, with a maximum of 5 pairs per line. Within this function, use a loop to create 20 pairs of random numbers:1) The first number in each pair should be within the range of 1 to 50, inclusive.2) The second number in each pair should be within the range of 51 to 100, inclusive. For each pair, print the two numbers side by side, separated by a space. Separate each pair with a comma. After every 5 pairs, start a new line. After all 20 pairs have been generated, display the total count of pairs in which the sum of the two numbers is divisible by 7.1- Write a python function that takes a number as a parameter and returns true if the number entered by the user is a integer and returns false otherwise.2- Write a python function that takes a number as a parameter and returns true if the number entered by the user is a float and returns false otherwise. 3- Write a function that takes in one integer as a parameter. It makes sure that the number is indeed an integer and prints the sum of all its digits. Sample input: 145Sample output: 1+4+5=10
- Write a C++ program to calculate a rectangle's area. The program consists of the following function: getLength - This function should ask the user to enter the rectangle's length. and then returns that value as a double • getWidth - This function should ask the user to enter the rectangle's width. and then returns that value as a double. • get Area - This function should accept the rectangle's length and width as arguments and return the rectangle's area. • displayData - This function should accept the rectangle's length, width and area as arguments, and display them in an appropriate message on the screen. main - This function consists of calls to the above functions.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Create a function that takes an integer and returns Trueif it's divisible by 100, otherwise return False. Example: divisible(500) → True divisible(8) → False WRITE IN PYTHON PLEASE
- I can both pass and return an array value from a function. Group of answer choices: True False this is for c++C++ The file text.txt contains a sentence text written in all small letters and does not have any punctuation marks, no numbers, no symbols except for spaces. You are required to write a program which accepts an operation code, and zero to two inputs depending on the operation code. Based on the operation code, you will call three versions of the overlaoded function textProcessing as follows: Operation 0: The function removes all vowels from the ORIGINAL sentence. The vowels considered are the small letters (a, e, i, o, u y, and w). Operation 1: The code further asks for one lowercase letter to be input by the user. If the character is not a lower case letter, the code outputs Invalid. The function returns the distance (difference) between the letter first occurence and last occurence in the text. If the letter does not occur in the sentence, it returns 0. Operation 2: The code asks for two lowercase letters to be input by the user. If the characters are not lower case letters, the…1- Write a python function that takes a number as a parameter and returns true if the number entered by the user is a integer and returns false otherwise.