Describe how an individual's genotype influences their chance of contracting malaria: Which individual is more likely to get malaria-an individual with two HbA alleles or an individual with one HbA allele and one Hbs allele? Why do people with one Hbs allele tend not to get malaria? 0n PRCE to be distorted into a

Q: Q4. Describe the four levels of protein structures. Include information about the bond between amino...

A: There are four levels of protein structures:-  Primary Secondary Tertiary Quaternary Primary Struc...

Q: Click and drag the labels to accurately label this histological section from the endocrine system. O...

A: Graafian follicle is a mature ovarian follicle . Ovarian follicle found in organ ovary.  

Q: According to the director of addiction services at the U of IL Hospital and Health Sciences System, ...

A: Option B.  

Q: How many N-terminus are there in this cartoon?

A: *There are four types of protein structure are present. primary structure secondary structure terti...

Q: You are culturing bacteria using a petri dish, the bacteria grow very well on this plate you have. H...

A: Number of bacteria per ml of a sample is represented by colony forming units(CFU) per ml.CFU refers ...

Q: Compare and contrast gametogenesis in starfish and sea urchin.

A: Answer--

Q: The reactants and products of the light reactions. Explain how light supports the light reactions wi...

A: According to our guidelines we can answer only the first three subparts of the question. So, please ...

Q: 2- Supposed that you have a DNA sequence sample with 10,000 bp. By using 2 different restriction enz...

A: The answer is 3.

Q: An organism that harvested energy from electricity and got carbon to build biomolecules by harvestin...

A: In the ecosystem different organisms interact with each other. In the ecosystem a food web is observ...

Q: Can you answer the last three q

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Amp...

Q: Which of the following is true of addiction? a) When the program asks a participant to move to a tre...

A: The correct answer is - All are true statements.

Q: ENDEMIC SPECIES IN THE PHILIPPINES Eggs with Shells No. Vertebrae Hair Wings Bilateral Symmetry 1 Ph...

A: Phylogenetic tree is a representation in which relationship of taxon with each as well as it's ances...

Q: 4. Clouded leopards are a medium sized, endangered species of cat, living in the very wet cloud fore...

A: Given information Clouded leopards are medium-sized species. XN is normal spots sex-linked dominant...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: . You are provided with the DNA sequence in the leading strand template. See item number 1 in worksh...

A: DNA is a molecule that carries the genetic information for the individual. 

Q: Most healthy body cells spend the majority of their lives in_____ . a. prophase d. telophase b. meta...

A: Introduction All living organisms are made up of cells, which are the basic building components. The...

Q: Question:- Describe the mode of action beta-lactam, aminoglycosides, polyenes, and quinolone antimi...

A: Antimicrobial agents act by interfering with the following factors of the bacterial cells:a) protein...

Q: how do plants synthesize carbohydrates through chemical reactions

A: Synthesis is a process by which plant water and carbon dioxide in the presence of sunlight and make ...

Q: How can people effectively manage stress when diagnosed with cardiovascular conditions?

A: When people diagnosed cardiovascular conditions than how can manage stress

Q: There are six basic categories of enzymes. Which enzymes remove electrons from, or add electrons to,...

A: According to Enzyme commission (EC), enzymes has been classified into 6 basic categories. These enzy...

Q: Homeotic gene expression _______. a. occurs via bacterial operons b. maps out the overall body plan ...

A: These are the genes which helps in the development of anatomical structures. Types of Gene Regulatio...

Q: Describe the main functions of the different components of the ATP synthase enzyme in the mitochondr...

A: ATP synthase is enzyme which is responsible for synthesis of ATP molecules.ATP synthase found in mit...

Q: You are a population ecologist studying animals in a national park, and park managers are asking for...

A: Earth houses a large number of species in its biosphere.

Q: What is the nature of the targeting sequence, and what distinguishes it from other types of targetin...

A: Introduction  In the cell, there is a highly regularized transport mechanism that works for the tran...

Q: List the main events that occur during each stage of mitosis.

A: Introduction: The process of cell division that results in the formation of two new daughter cells i...

Q: Hello, can you pls explain the 5 different swimming styles and strokes. Thank you.   • freestyle ...

A: Answer  5 different swimming styles and strokes 1.free style 2. Back stroke 3. Breast stroke 4. Butt...

Q: Clumped dispersion patterns.. arise when local resources are depleted. arise due to aggressive inter...

A: As per our company guidelines we are supposed to answer only first question.  kindly repost another ...

Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription - Transl...

A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins (...

Q: ADH1A alcohol dehydrogenase 1A (class I) Describe a way in which the gene can be manipulated to trea...

A: * The gene ADH1A alcohol dehydrogenase  gene encodes a member of the alcohol dehydrogenase family. a...

Q: Mitochondrial oxidation of fatty acids is a major source of ATP, yet fatty acids can be oxidized els...

A: Introduction  All cells require energy to survive and energy comes from respiration or metabolism. T...

Q: How do selective-serotonin reuptake inhibitors (SSRIS) increase serotonin in the synapse? O They cau...

A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Ser...

Q: 4. Complete the Pair the gametes inside the boxes. Ab ab ав АВ AaBb АВ AABB AAbb AaBb Ab aaBB aaBb а...

A: Note - we are supposed to answer 1 question according to the guidelines. Please repost the activity ...

Q: Chromosome All possible chromosome configurations at diakinesis Mutation number wwm Monosomy Trisomy...

A: Aneuploidy occurs due to loss or gain of one or more chromosome. 

Q: What is transpiration

A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...

Q: The reactants and products of the light reactions. Explain how light supports the light reactions wi...

A: According to our guideline we can answer only the first three subparts of a question. So, please upl...

Q: In a population of interest, 1 in 4000 women are affected with haemophilia A, an X-linked recessive ...

A: Above scenario based on evolutionary genetics, Hardy Weinberg equilibrium. Let's assume frequency of...

Q: Which of the following statements is incorrect? a. Some gene expression patterns can be passed to an...

A: The epigenetic regulation of gene expression is considered a very common process. This plays a major...

Q: Put the trophic levels in order such that (a) likely has the lowest concentration of mercury. apex p...

A: Introduction :- In natural environment , organisms are categorised into different trophic levels acc...

Q: which cellular function is performed by only some types of cells? obtaining nutrients and chemical ...

A: Cells must perform functions in order to support and maintain life, that is cellular functions, such...

Q: In corn, kernel color is governed by a dominant allele for white color (W) and by a recessive allele...

A: As given in question dominant allele for white kernel color is denoted by W. Recessive allele for ye...

Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?

A: Apes meaning and explanation For much of history, people have used the terms "monkey" and "ape" inte...

Q: Biochemical Molecular analysis of the bela glo Saudi sickle 3. Describe the effect of thelamino acid...

A: Introduction :- Amino acids are the building blocks of any polypeptide or protein structure . The se...

Q: Explain the steps of meiosis in a diploid (2n ) cell.

A: Meiosis is a cell division that makes four daughter cells from a single parent cell.  

Q: Describe and compare cytokinesis in animal and plant cells

A: Cytokinesis is the process by which the cytoplasm of the cell divides after the M phase.  

Q: 17. A culture of Spirogyra (an autotrophic alga) is maintained in a water solution containing dissol...

A: Lifeforms are composed of 4 biomacromolecules. They are carbohydrates, proteins, lipids and nucleic ...

Q: Match each stage with the events listed. ___ metaphase                  a. sister chromatids move ap...

A: Metaphase is referred to as a stage where there is a condensation of chromosomes occurs. In prophase...

Q: What principle is involved in the isolation of albumin?

A: Albumin is protein that is made by the liver, Albumin helps to Keep fluid in the bloodstream. It car...

Q: In pea plants, purple flowers are dominant over white flowers. A heterozygous purple plant is crosse...

A: Alleles are alternative form of  a gene that are located on the same locus of homologous chromosome ...

Q: Edmontosaur or hardosaurs what ways can they defend itself from predators like large with powerful j...

A: INTRODUCTION Endmontosaurs They are large dinosaurs lived in North America during late Cretaceous pe...

Q: Distinguish sister chromatids from homologous chromosomes.

A: Homologous Chromosomes Diploid cells have two sets of chromosomes, which are referred to as homolog...