Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your answer. TACGATCGACGGACAGGCCTTAAGCGA 1. Break the DNA sequence into triplets of letter. Draw a vertical line to separate the three-letter code or codon. 2. Give the complementary strand of the separated 3-letter code. 3. Transcribed the 3-letter code into mRNA (messenger RNA). 4. Using the transcribed mRNA code, translate it into amino acids.

Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your answer. TACGATCGACGGACAGGCCTTAAGCGA 1. Break the DNA sequence into triplets of letter. Draw a vertical line to separate the three-letter code or codon. 2. Give the complementary strand of the separated 3-letter code. 3. Transcribed the 3-letter code into mRNA (messenger RNA). 4. Using the transcribed mRNA code, translate it into amino acids.

3-2-1 Code It

6th Edition

ISBN:9781337660549

Author:GREEN

Publisher:GREEN

Chapter3: Icd-10-cm And Icd-10-pcs Coding Conventions

Section: Chapter Questions

Problem 1.1MC

See similar textbooks

Similar questions

Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
Directions Please do some out of class research to help you answer the questions below. Please include a url and page/video title to indicate where you found your information. Prompt Sometimes, changes or “mutations” occur that prevent genes from doing their job properly. Certain mutations in the BRCA genes make cells more likely to divide and change rapidly, which can lead to cancer. If you inherit a mutated version of a BRCA gene, does this mean you are guaranteed to develop cancer? What other changes must occur for cancer to develop? Citation required.
not writing assignment!!!!!!!!! could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their Clinical Applications example of what i want is below - just follow the format no need to do it i just need a format for the topic
Complete the sentences. Each term may be used more than once. In a circular bacterial chromosome, the structure of DNA is a If DNA is twisted in the Overwinding results in If DNA is twisted in the Underwinding results in One effect of double helix. direction, it becomes overwound. supercoiling. direction, it becomes underwound. supercoiling. double helix. Answer Bank positive negative right-handed left-handed supercoiling in bacterial chromosomes is to promote separation of the two strands of DNA in the
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
III. ESSAY Directions: Read and understand the passage carefully. Write an essay on the space provided in answer to the given question below. Your essay will be graded based on the rubrics presented. (Refrain from searching the internet for your answers to avoid plagiarism check.) "COVID-19 is an infectious disease caused by SARS-COV-2 or the coronavirus. It directly affects our respiratory and circulatory systems. According to the World Health Organization (WHO), most people infected with the COVID-19 virus will experience mild to moderate respiratory illness, and others have no symptoms at all. In some cases, however, COVID- 19 can lead to respiratory failure. lasting lungs and heart muscle damage. nervous system problems, kidney failure or death. If that is the case, how can you make your respiratory and circulatory systems healthy to prevent being infected by the virus?" Answer:
ANSWERS 1-4 were answered but I need 5 answered please. 5. ANSWER QUESTIONS BELOW PLEASE: A. Repeat number 4 (a through d), except do a deletion or insertion mutation, by subtracting or adding a nucleotide from the original DNA sequence from number 1. (Don’t forget to rewrite the original DNA sequence, and mutated DNA strand.) B. C. D. Indicate if the results of the mutation is always beneficial, always harmful or always neutral. QUESTIONS ANSWERED BELOW Answer 1) The sequence of template strand in 3' to 5' sequence is: 3' TACCCGCCAGCCTACATC 5' Answer 2) The mRNA strand is complementary to the template strand. The RNA polymerase synthesises mRNA. The A, U, G and C are present in mRNA with respect to the T, A, C and G in DNA. The mRNA sequence is: 5' AUGGGCGGUCGGAUGUAG 3' The mRNA sequence in form of codon is: 5' AUG GGC GGU CGG AUG UAG 3' The codon is made up of three nucleotides. Answer 3) The mRNA codon chart helps to find the sequence of amino acid from a codon. The…
how do i expand this into 1000 words for a result section of a report The objective is to interpret the results of an RNA-Seq analysis to identify differentially expressed genes in breast cancer using figure 1. The data provided includes gene symbols, chromosome location, start and end points, strand, fold change, log2 fold change, p-value, and false discovery rate (FDR). The RNA-Seq analysis has identified several genes that are differentially expressed in breast cancer. These genes are located on various chromosomes and have varying levels of fold change, indicating the degree to which their expression levels differ between normal and cancerous cells. The gene with the highest fold change is EYA4, located on chromosome 6, with a fold change of 3604.4176. This indicates that the expression of this gene is over 3600 times higher in cancer cells compared to normal cells. The log2 fold change is 11.81555, which is a measure of the magnitude of the difference in gene expression. The…
Complete the sentences about unusual DNA structures. is a DNA repeat that does not have a complementary sequence in the same strand. some secondary structures. Any sequence, such as a palindrome, that can be rotated 180° horizontally and 180° vertically such that it superimposes a sequence repeat on another sequence is In refers to self-complementarity within a strand. This sequence may contribute to the formation of A four-stranded, right-handed helix formed by a DNA segment containing a high proportion of guanine residues is known as The sequence An example of an inverted repeat that occurs within a single DNA strand is -GTGAG... .CTCAC- -CACTC. .GAGTG- interstrand hydrogen bonds break and intrastrand hydrogen bonds form. .. is which has the potential to form can form when a polynucleotide strand forms major groove of a homopurine-homopyrimidine duplex that contains a mirror repeat. A single DNA strand with the sequence - ATATG with functional groups in the CATAT- can form a…
Directions: Answers must be precise and concise. You can use other sources of information related to the topic. Write down your responses on a separate answer sheet. 1. What is the role of recombinant DNA technology in improving life? Elaborate on your answer. 2. How will knowledge of recombinant DNA technology be useful to resolve the current challenges and issues we are facing today? Cite an example.
I need help writting a biological "title" for this lab report. I performed 5 labs which are PCR purification, Rapid ligation, and Transformation, Blue/White screening and observation of pGreen transformation, Plasmid Extraction and Restriction Enzyme Digestion, Soil DNA extraction and gel electrophoresis, and Bioinformatics Analysis of 16s rRNA genes. Note; I attached one page of my abstract and one page of the introduction
UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN) a. What are the applications of modern biology in biotechnology? b. What are the implications of these applications? c. How do you think these applications will change the world in the future?