Answered: Disruptive selection is the promotion…

Disruptive selection is the promotion of _____. the standard form of a trait human influence a favored extreme trait all extreme forms of a trait

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter17: Processes Of Evolution

Section: Chapter Questions

Problem 3SA: Match the modes of natural selection with their best description. ____ stabilizing a. eliminates...

See similar textbooks

Related questions

Q: 4. Zymogens are an interesting class of proenzymes. Describe the biochemical changes that have to…

A: Proenzymes are proteolytic in nature. They are in inactive form in blood. They are activated by…

Q: What is the role of gp120 in HIV infection?

A: The virus known as HIV (human immunodeficiency virus) targets the immune system of the body. HIV can…

Q: Explain how life is in the blood by using at least 5 biological key terms such as plasma,platelets,…

A: Biological Explanation:In the context of biology, life in the blood is intricately tied to its…

Q: Yeast + hydrogen peroxide observation a. feels warm to the touch b. feels cold to the touch c.…

A: The question is asking about the type of reaction that occurs when yeast is mixed with hydrogen…

Q: Please provide a detailed description of Chronic Obstructive Pulmonary Disease (COPD) focusing on…

A: Here's a detailed description of Chronic Obstructive Pulmonary Disease (COPD), covering its…

Q: A 65-year-old man with severe atherosclerotic coronary artery disease comes to the emergency…

A: The objective of the question is to identify the most likely biological process that would result in…

Q: An experiment is conducted in which the mitochondrial content of various tissues is studied. It is…

A: The objective of the question is to identify the type of cell that has the highest mitochondrial…

Q: What role do transcription factors play in transcription?

A: The process of copying genetic information from DNA into a complementary RNA molecule is called…

Q: 4.Which of the following terms includes all the others? a) Karyokinesis b) Cytokinesis c) Cell Cycle…

A: The cell is defined as the basic structural and functional unit of an organism. It is the building…

Q: methyltransferase (TPMT) levels is correct? 27. In the context of 6-mercaptopurine (6-MP) therapy…

A: 6-Mercaptopurine (6-MP) is an important drug used in the treatment of leukemia and other conditions.…

Q: Classify the given items with the appropriate group. Neuron is hyperpolarized Occurs when…

A: Relative Refractory PeriodNeuron is hyperpolarized: This occurs during the Relative Refractory…

Q: How viruses are different than bacterial or animal cells

A: A virus is a non-cellular particle with genetic material and protein that can invade a living…

Q: An attempt to transfer bacteria into new media during the death (Decline) phase of a culture…

A: Microbial cultures, also known as microbiological cultures, are made by allowing microbial organisms…

Q: Match the muscle type to its main characteristics Smooth muscle Cardiac muscle Skeletal muscle…

A: Match the following

Q: Question for assignment: Using a transgenic technique, propose an experiment to determine whether…

A: The objective of this question is to design an experiment using transgenic techniques to determine…

Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…

A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…

Q: Which of the following is an incorrect statement about the inheritance of the ability to taste the…

A: Phenylthiocarbamide (PTC) is a chemical compound regarded for its bitter flavor. The capacity to…

Q: What is the difference between microevolution and macroevolution?…

A: The objective of the question is to understand the difference between microevolution and…

Q: Which of the following statements regarding hemoglobin (Hb) saturation are true? a. On top of…

A: The question is asking us to evaluate the truthfulness of several statements about hemoglobin (Hb)…

Q: The molecular structures of linoleic acid and palmitic acid, two naturally occurring substances, are…

A: To identify which molecule is more likely to be solid at normal temperature using the chemical…

Q: a) Let's say the two motif hits (CCACGAG and CCGCCAG respectively) turn out to be evolutionarily…

A: Motifs are mainly short, conserved sequence patterns that are associated with specific function of a…

Q: in considering the interaction of multiple genes involved in complex traits and interaction with the…

A: The organism's genotype represents the specific set of genes that it carries. These genes are…

Q: Strato of Lampsacus, a student of Theophrastus in Aristotle’s Lyceum, made which of the following…

A: The question is asking about the contradiction made by Strato of Lampsacus, a student of…

Q: Subject: Environmental Physiology Explain how the differences in the thermal characteristics of…

A: The objective of this question is to understand the impact of thermal characteristics of terrestrial…

Q: for the Spinothalamic Tract, can you show me a diagram for the pathway from the peripheral…

A: The spinothalamic tract is a sensory highway carrying pain, temperature, and crude touch sensations…

Q: Aristotle classified all cold-blooded egg-laying tetrapod vertebrates as: the oviparous quadrupeds…

A: Aristotle's taxonomy of animals provides a fundamental insight of how ancient scholars classified…

Q: My Courses D uizzes/4305259/take Question 2 O 0% x EBook - SRH - Go__ x X x Book Outline-SF X In…

A: The first part of the question is asking for the probability of offspring rabbits being spotted if a…

Q: Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of…

A: A frameshift mutation occurs when nucleotides are inserted or deleted from the DNA sequence, causing…

Q: How tablet compression should be done? I mean what is the best time for it?

A: The objective of the question is to understand the process of tablet compression and to determine…

Q: Exercise 2: Natural Selection 4. The different types of beaks on Darwin's finches can be thought of…

A: Each seed within a type (e.g., sunflower seed) will have slight variations in color, shape, or even…

Q: CIIVII Oent. Clean rolesT Phenotype Frequency Allele Frequency Genotype Frequency Environment:…

A: The allele and genotype frequencies of a popular can be calculated by using the equations of…

Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…

A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…

Q: Subject: Environmental Physiology Explain how the differences in the thermal characteristics of…

A: The thermal characteristics of terrestrial and aquatic habitats have profound effects on the…

Q: Theophrastus of Lesbos, Aristotle’s successor as head of the Lyceum, improved upon Aristotle’s…

A: The question is asking for the correct classification of dicotyledons, a group of flowering plants,…

Q: Frequencies (in %) of mosquitoes by kdr genotype www Pre-2006 2006 Post-2006 +/+ + /r A.gambiae…

A: The inquiry is about how the kdr (knockdown resistance) genotype frequencies fluctuate over time in…

Q: If the nucleotide sequence of an anticodon was AUC, then the DNA triplet would be: O TAG O ATC O AUC…

A: A DNA triplet is a sequence of three consecutive nucleotides that code for a given amino acid. Amino…

Q: 5. Based on your understanding of allosteric regulation and using terminology related to the…

A: Glycogen phosphorylase is a key chemical involved in glycogenolysis, the breakdown of glycogen into…

Q: How do attributes and properties defined in a frame align with the broader hierarchical taxonomic…

A: Frames are utilized to hold the attributes and properties of the concept or object in question and…

Q: Subject: Environmental Physiology Explain how the differences in the thermal characteristics of…

A: The objective of this question is to understand how the thermal characteristics of different…

Q: From your graph, estimate the P50 for normal hemoglobin and the mutant corresponding to your student…

A: p50 represents the partial pressure of oxygen required to achieve 50% saturation of hemoglobin. This…

Q: Describe three notable characteristics common to most reptiles. Think about diet, dentition, limbs,…

A: The first characteristic to consider is the diet and dentition of reptiles. Most reptiles are…

Q: Explain(in terms of biological or chemical impacts on aquatic ecosystems) why plant nutrients…

A: The objective of the question is to understand why plant nutrients are considered the worst kinds of…

Q: Becca loves German Shepherds and wants to have one as a pet. She locates a breeder and agrees to…

A: The objective of the question is to identify the type of selection that occurs when humans intervene…

Q: During an experimental study, an investigator finds that the regulation of cell cycle and programmed…

A: The question is asking about the mechanism by which the mitochondrion can initiate the regulation of…

Q: Which of the following arithmetical series contains only prime numbers (with no composites)? 1, 4,…

A: The objective of the question is to identify the series that contains only prime numbers. A prime…

Q: The following image depicts the results of undigested PCR product, and Lane 3 is the restriction…

A: Answer is true .Lane 2 is the undigestive pcr product and the Lane 3 is the digestive product…

Q: In which of the following organs are fenestrated endothelial cells common? A. Heart B. Liver C.…

A: The question is asking us to identify the organ where fenestrated endothelial cells are commonly…

Q: What is the origin (or origins) of viruses? Is there evidence that viruses have multiple origins?

A: The origin of viruses is a topic of debate among scientists. There are three main theories about the…

Q: a.. b.. C. d.. g. h..

A: The animal cell is a type of eukaryotic cell that exists in animal organisms. In animal cells, there…

Q: What do cells need to take in from the bloodstream to get usable energy?

A: The question is asking about the substances that cells need to absorb from the bloodstream in order…

Concept explainers

Health Epidemiology

Health is an essential factor for all human beings. For all humans, health is a critical factor. An individual's ability to meet life's challenges and retain his or her capacity for optimal functioning is reflected in his or her condition of health. This needs the physical, mental, and biological parts of one's constitution to maintain a degree of functioning that has a favorable influence and support for one another.

Question

Disruptive selection is the promotion of _____.

	the standard form of a trait
	human influence
	a favored extreme trait
	all extreme forms of a trait

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Genetic drift is most likely to affect:a. every population, regardless of sizeb. small populationsc. large populationsd. large and diverse communities
A(n) _____ makes a species better suited to its environment.a. homologous traitb. adaptationc. analogous traitd. mutation
Which factors can prevent permanent fixation of an allele (i.e. maintain genetic diversity)? Hint: You're going to have to try different values than just those presented in the exercise--try to keep both alleles present! Answer choices: Gene Flow Genetic Drift Natural Selection Mutation
The frequency of two allele in a gene pool is 0.19 (W) and 0.81 (w). What is the percentage in the population of heterozygous individuals homozygous recessives
People who are heterozygous for the cystic fibrosis gene are morelikely than others to survive a cholera epidemic. This heterozygoteadvantage seems to explain why homozygotes are maintained in thehuman population, and is an example ofa. disruptive selection.b. balanced polymorphism.c. high mutation rate.d. nonrandom mating.
The arrows in the top says GREATER GENETIC INFLUENCE and on the bottom it says GREATER ENVIRONMENTAL INFLUENCE. There should be no reason for u to not doing this question. I provided a clear graph. DO NOT COPY from google use the graph to answer those question USING THOSE TWO vocabulary words.
It is estimated that every human carries at least one recessive lethal allele (i.e. they are heterozygotes at that locus). What maintains these alleles in populations given their lethality when homozygous? Group of answer choices heterozygote disadvantage mutation/selection balance inbreeding genetic drift
Boxers are far more inbred than poodles. Why does that inbreeding make the former a better target for genetic studies of disease than the latter?
In a population of 1000 baby kitties, 40 are white because of a recessive allele (b). Non-white cats are either homozygous dominant (BB) or heterozygous dominant (Bb). What is the frequency of heterozygous kitties in the population?A. 0.2B. 0.32C. 0.8Please show all the work!
A derived trait ... Group of answer choices A: is something we develop in our lifetime and pass on to our children B: All of these answers are true C: shares characteristics with an ancestral trait, but has adapted differently among different species. D: is the same thing as an analogous trait.
I had trouble with explaining how natural selection affects alllele and genotype frequency. Does natural natural selection affect alleles by causing adaption to happen increasing the frequency of advantageous alleles?
two color variations: bright blue and bluish-gray. Bright blue coloration is a recessive condition that is rare in the original population (less than 5% of the birds have the trait). A small flock of 5 wrens is blown by a storm onto a new island that is 100 miles away from their old home. 3 of the 5 birds were blue-gray and the other 2 were bright blue. This new population thrives on the island as it is the only bird species present on an island with lots of food and no predators to hunt them. Over the next 10 years, the 5 birds and their descendants reproduce and populate the island, creating a population that is made up of about 40% bright blue wrens. later, a hawk species is blown over to the island. This hawk hunts the smaller wrens using its excellent vision. The bluish-gray birds blend in better with the landscape compared to the bright blue birds. Name the specific mechanism of microevolution that the wren scenario displays when they were first blown over to the new…