1. You are given the following DNA sequence andyou want to know what protein it codes for.DNA: TACGGGCCTATACGCTACTACT CATGGATCCorresponding mRNA sequence:Corresponding amino acid sequence (use thechart from before):2. You are given the following DNA sequence andyou want to know what protein it codes for.DNA: GTACGCGTATACCGACATCorresponding mRNA sequence:Corresponding amino acid sequence (use thechart from before): Codon chart: We interpret mRNA 3 base pairs at a time.This is known as a codon. A codon table can be used totranslate a genetic code into an amino acid sequence.The full set of relationships between codons and aminoacids (or stop signals) is called the genetic code. Thegenetic code is often summarized in a table like the onebelow.Second letterAGUUUUUC JUGU CysUCU)UCCUCAUCGJUAUUPheTyrUACSUGCJSerUAA Stop UGA Stop AUAG Stop UGG TrpUUAUUG FLeuGCUU )CỤCCUACUGCCU )СССССАCCGCGUCGCArgCAU)CÁC HisСААLeuProCGAGinCAGCGGAUUAAUACUАСCACAAsnAGUSerAAC JAsh AGC.AUC leAAUAAGA ArgThrAAAAAG.}LysAAUG Met ACGAGG JGGUUGUCGValGUAGUGGCU)GCCGCAGCGGAU1GACSGAA)GAG GluGGUGGCGlyUCAAlaGGAGGG]GFirst letterUUAGThird letter

Name: 1. You are given the following DNA sequence andyou want to know what
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. You are given the following DNA sequence andyou want to know what protein it codes for.DNA: TACGGGCCTATACGCTACTACT CATGGATCCorresponding mRNA sequence:Corresponding amino acid sequence (use thechart from before):2. You are given the following DNA

DNA consists of two strands which wind around each other, backbone of the DNA is formed by the…

Science

Biology

DNA: TACGGGCCTATACGCTACTAC T CATGGATC Corresponding MRNA sequence: Corresponding amino acid sequence (use the chart from before): 2. You are given the following DNA sequence and you want to know what protein it codes for. DNA: GTACGCGTATACCGACAT Corresponding MRNA sequence: Corresponding amino acid sequence (use the chart from before):

DNA: TACGGGCCTATACGCTACTAC T CATGGATC Corresponding MRNA sequence: Corresponding amino acid sequence (use the chart from before): 2. You are given the following DNA sequence and you want to know what protein it codes for. DNA: GTACGCGTATACCGACAT Corresponding MRNA sequence: Corresponding amino acid sequence (use the chart from before):

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
A small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.
he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use during replication? ATTCGATGC TACGGATCG CAGTGACTT PROTEIN SYNTHESIS TRANSCRIPTION Use the DNA strands provided to create the m-RNA strands Which nitrogen base CAN'T you use during transcription? ACTGGATAC ACGGATCGT TGACAGCT A TRANSLATION: USE the DECODING WHEEL to DETERMINE the AMINO ACID that Which amino acids have ONLY ONE corresponds to the m-RNA CODE GIVEN: codon? MRNA CODE AMINO ACID AAA GCG Tyrosine Stop GAU Alanine GU A C CAA GU Cysteine Stop Loyptophan U CAC Valne UUU Arginine AC A Leucine Serine Which two mRNA codes correspond to histidine? lysine A Proine Asparagine CACUCA How many different MRNA codes correspond to Threonine? Tell the amino acid sequence for the following MRNA message: MRNA MESSAGE: AUG CCA UGG CAU Phenyl- alanine Leucine Serine aid Aspartik Glutamk Glydne acid Methionine soleucine Histidine Glutamine Arginine Threonine
For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGA
Amino acid sequence: Look at the m-RNA message below: PUT A NUMBER under each of the t-RNA/amino acid complexes to show the correct sequence that they would attach as this message is read. phenylalanine leucine lysine methionine AUGUUC A A ACUG UUU UA MRNA WHAT IS THE AMINO ACID SEQUENCE FOR THE PROTEIN THAT WOULD BE PRODUCED FROM THIS MESSAGE? MATCH THE PARTS IN THE DIAGRAM WITH THE CORRECT LABEL. RIBOSOME в Asparagine D. NUCLEUS Methionine MESSENGER RNA ANTICODON E AMINO ACID CODON TRANSFER RNA
A small section of mRNA codons has the following sequence:UGU GGU CAA CCG Some Amino Acids Valine Serine Proline Glycine Arginine Leucine Histidine Cysteine Glutamine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.