Q: Name the specific names of cells found in adipose tissue
A: Introduction Cells that make up connective tissue are surrounded in a protein-rich extracellular…
Q: briefy explain 3 examples of pseudoscience that are related to evolution, or which discredits…
A: Introduction: The words "pseudo" and "science" are combined to form the definition of pseudoscience;…
Q: Is protein a tertiary structure?
A: Introduction: Protein is a crucial macronutrient found in all living things . In our muscles, bones,…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: Write the class that exhibits the followin characteristics: Presence of velum in medusae Hydrozoa…
A: Velum is a membrane or membranous structure that covering another structure.planula is free-swimming…
Q: was es The scientists develop a computer simulation that will let them test how changes to the…
A: Introduction Increased genetic diversity leads to increased chances of survival of a species. This…
Q: Medical researchers discover a new compound, known as Serenity, which has been shown to be effective…
A: A hypothesis is an assumption, an idea that is proposed for the sake of argument so that it can be…
Q: Question 2: DNA repair enzymes preferentially repair mismatched bases on the newly synthesized DNA…
A: The mismatch repair mechanism recognizes and fixes base mismatches created during DNA replication…
Q: Based on cell theory, how do new cells arise? O They come from the division of other cells The arise…
A: Introduction :- The scientific idea that cells make up living things, that they are the fundamental…
Q: Classify and characterize the plant-like protists (algae) based on the following parameters.…
A: Note: As Per Guidelines, we can answer 3 sub-parts of a question at one time. Please ask rest…
Q: Is natural selection random with respect to fitness?
A:
Q: The Size of Cells and Their Components: a. (a) If you were to magnify a cell 10,000 fold (typical of…
A: The microscope is the instrument used in biology laboratories to visualize microscopic particles or…
Q: Differentiate between the roles of the atrioventricular and semilunar valves.
A: The heart has valves to maintain the unidirectional flow of blood, called the heart valves. This…
Q: Differentiate the Cimex sp. versus Ixodes sp. based on their morphology, ecology and/or behavior
A: Introduction: Insecta is an important class of the phylum Arthropoda. Some of their characteristics…
Q: Based on your knowledge of oxidative phosphorylation, explain why there is an increase in…
A: The process of oxidative phosphorylation is referred as a redox reaction that involves the transfer…
Q: Waste & dead matter Heat द -COMPOSERS Heat Heat Heat Heat Quaternary consumers Tertiary consumers…
A: Ecological pyramid - An ecological pyramid is a graphical representation, that shows a relationship…
Q: Among the different fields or disciplines of biochemistry, which do you think is the most applicable…
A: Introduction Biology is a vast topic that can be discussed in depth and it would turn into an essay.…
Q: A region of a eukaryotic chromosome that is gene-rich (i.e. contains many genes) would be expected…
A: The presence of a membrane-bound nucleus is the primary feature that distinguishes a eukaryotic cell…
Q: Define adaptation. How could you use a comparative approach to test whether mesoglea within a…
A: modification of an organism or one of its components to improve its suitability for survival in its…
Q: 3. We discussed seven points regarding the attributes of life. What are the 7 points and how do they…
A: The attributes of life are Cellular organization, reproduction, growth & development, energy…
Q: PURPLE VESTIGIAL DIHYBRID TESTCROSS In the parental generation, you mate a pure-breeding wild-type…
A: Recombination frequency is the number of organisms that are produced from a genetic cross. The…
Q: A researcher sequences the Pitx1 gene in a population of 100 stickleback fish that is known to…
A: Introduction Gene is the basic unit of heredity. Genes are the segment of DNA which controls all…
Q: Introduction: The introduction explains the purpose and objectives of the experiment. A good way to…
A: The collection of methods in biology known as "experimental biology" focus on using experiments to…
Q: E. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…
A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…
Q: Write only the class that exhibits the following characteristics
A: All marine creatures perform critical roles in their ecology. Plankton, on the other hand,…
Q: What do we get from each macromolecule? What is an enzyme made of?
A: Biomolecules are the organisc molecules that is found in the living organism. THese act as building…
Q: Do flexable adapter molecules not play a part in this?
A: flexable adapter molecules An antibody is a flexible adaptor molecule which is a kind of protein of…
Q: State one example of an emergent property. Describe how a feature of the whole is not observed in…
A: A property that develops as a result of joining individual elements or components into a system is…
Q: Phylum Habitat Symmetry Porifera Cnidaria Ctenophora Germ Layer Give two classes belonging in each…
A: The concept of the five kingdom classification was given by Robert Whittaker. All biological…
Q: Differentiate between the roles of the superior vena cava and the inferior vena cava.
A: Superior and inferior vena cava are the two main veins of the body that drain deoxygenated blood…
Q: 11. This bacterium can be both helpful in our lower digestive tract and harmful to our upper…
A: Introduction Bacteria are common, largely free-living organisms that frequently only have one…
Q: 2. Fill in the table: Major steps in Photosynthesis Does this step depend on any other step?…
A: Photosynthesis is the process through which plants convert sunlight, water, and carbon dioxide into…
Q: Draw an aquatic food chain with at least one producer ane 3 animals make sure to point arrows in the…
A: In the ecosystem different species interact with each other and form an ecological community. The…
Q: What is Chemical Pollution and how can we prevent it?
A: Any undesirable, harmful, poisonous particle in the air is called pollution. These particles are…
Q: Give similarities and differences between the following: a. ecologist vs. environmental scientist b.…
A: Ecology is the study of the relationship and interactions of different components of a habitat. The…
Q: Explain how the body responds to stress by addressing the following aspects of neural processing:…
A: 1) one sensory organ that is responses to the external stimuli is ear. Sensory or sensory organs…
Q: 1 influence the velocity of the action potential along a dendritic fiber, once elicited, EXCEPT
A:
Q: Differentiate the Pediculis humanus capitis versus Pediculis pubis based on their morphology,…
A:
Q: When considering similarity between species in heritable characteristics, the lack of homology is…
A: Both homology and analogies refer to identical components or characteristics of several species. The…
Q: Phospholipids (Which is charged, what is the functional significance? Are they preferentially…
A: Phospholipids are biomolecules that are composed of glycerol, phosphate group, and lipids/ fatty…
Q: Consider the graph below. This is an example of whatkind of natural selection? O Directional…
A: Stabilizing, directional, and diversifying selection either decrease, shift, or increase the genetic…
Q: In the following diagram, what is the correct term for the structures indicated by letter B?…
A: Histone Special group of proteins found in the nuclei of eukaryotic cells responsible for DNA…
Q: Which of the following systems is predominantly stimulated by nicotine action in parasympathetic…
A: Introduction: The smooth and cardiac muscles are innervated by the nerves that make up the ANS. The…
Q: Given the following traits that the parents have, assign the letters H for hair type, E for eyelids,…
A: A trait is characteristic feature that is unique to particular individual. A trait is represented by…
Q: Identify the charges (positive/negative) that appear on the inside AND the outside of an axon while…
A: Neuron Neuron is the basic functional unit of brain and spinal cord.
Q: All land plants produce. ______by mitosis and ____________ by meiosis. Selected Answer: spores;…
A: Introduction: The haploid and diploid generations of plants alternate during their life cycle. Only…
Q: ems Be sure to show your work. Zookeeper hypothesizes that changing the intensity of the light in…
A: A hypothesis is simply a suggestion. A hypothesis to be tested. It is still an open question, and we…
Q: Which among the parameters measured influences one another or are dependent with one another?
A: Variables In research, "variables are the things you want to study , control , measure and…
Q: Discuss the different methods of measuring onions and citrus physical characteristics/properties and…
A: Onion and lemon are two of the most important agricultural product in the globe. These two also fall…
Q: Which statement is the most accurate? All life is made of cells - no exceptions Most life is made of…
A: Prokaryotes:- the living organisms devoid of true nucleus are called as prokaryotes. These organisms…
Step by step
Solved in 2 steps
- Define peptide bondExplain the secondary and tertiary structures of polypeptide chains ?Disulfide bonds help to stabilize the three-dimensional structure of proteins. What amino acids are involved in the formation of disulfide bonds? Does the formation of a disulfide bond increase or decrease entropy (ΔS)?