During the process of DNA extraction with organic solvents (indicate which one/s are correct) O A. DNA is finally dissolved in water and kept frozen for further use O B. DNA is dissolved by the organic solvents O C. A solution at high pH precipitates genomic DNA from the aqueous phase O D. DNA is kept in the aqueous phase whereas proteins and lipids are solubilized in organic solvents like phenol and chloroform O E. Salt and ethanol are used to precipitate DNA from the aqueous phase

During the process of DNA extraction with organic solvents (indicate which one/s are correct) O A. DNA is finally dissolved in water and kept frozen for further use O B. DNA is dissolved by the organic solvents O C. A solution at high pH precipitates genomic DNA from the aqueous phase O D. DNA is kept in the aqueous phase whereas proteins and lipids are solubilized in organic solvents like phenol and chloroform O E. Salt and ethanol are used to precipitate DNA from the aqueous phase

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter10: Biotechnology

Section: Chapter Questions

Problem 2RQ: n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules...

See similar textbooks

Similar questions

n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to. . O a. Filtrates the contents of the blender to collect the strained fluid for DNA extraction O b. Precipitate the nucleic acid OC. Separate the DNA from the protein that folded and protected the DNA O d. Collect pure nucleic acid O e. Filtrate the mixture and precipitate the protein e here to search hp
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
All of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr A C. Uvr C D. Ligase E. Gyrase
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select one or more: O a. photolyase O b. nucleotide excision repair O c. mis-match repair O d. methyl-transferase
a. Cancer O b. Sickle cell anemia O c Chronic myeloid leukemia O d. Cystic fibrosis O e Tuberculosis The bisulfite sequencing is different from regular sanger sequencing of nucleotides because Bisulfite sequencing can sequence larger fragments of DNA O a. O b. Bisulfite sequencing can detect the deaminated cytosines in a DNA sequence O c. Bisulfite sequencing is more accurate than normal sequencing O d. Bisulfite sequencing can convert all cytosines to thymine O e. Bisulfite sequencing can differentiate between methylated and unmethylated cytosines
5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
9) The diagram to the right represents one technique used in biotechnology. The organic compound used to cut the bacterial DNA so that the human DNA could be inserted a(n)
In DNA and plasmid extraction using the kit method, silica membrane is used. How could the nucleic acid attach to the membrane? O by phosphodiester bonding to the silica matrix O by hydrogen bonding in high salt conditions O by covalent bonding between nucleic acid and silica O by hydrophobic bonding in high chaotrophic salt conditions
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
4. You isolate DNA from 1 ml of a suspension of E. coli cells using the procedure outlined in your lab handout. After completing the DNA isolation procedure, the total volume of the DNA solution is 700 µul. You transfer 80 µl of this DNA solution into 720 µl of TE buffer to create a diluted DNA solution. Using a spectrophotometer, you determine that the concentration of the diluted DNA solution is 440 µg/ml. a. How much did you dilute the original DNA solution? Express the dilution as a ratio. b. What is the concentration of the original DNA solution? c. How much total DNA did you isolate from the suspension of E. coli cells? d. How much total DNA was present in the diluted DNA solution?