Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the DNA you extracted be pure? What are the possible impurities?
Q: calculate the [PNP] in μM for each of these samples. For Table 2: Calculate the volumes of the 100…
A: 0.5mM =0.5 ×10-3 moles literi.e. 1 liter have 0.5 ×10-3 molesSo, 106 μL have 0.5 ×10-3 molesSo, 1…
Q: A total of 7.21 g of dry mixture with a protein content of 89.2% (w/w) determined by Kjeldahl…
A: % w/w tells us the grams of analyte in 100g of mixture. Hence, a protein content of 89.2% (w/w)…
Q: 4. Name this lipid. H₂C(CH₂) CH 0 CH₂-0-C-(CH₂)12CH3 0 CH(CH₂-C-0-CH COO™ CH₂-O-P-0-CH₂-CH 0 NH
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…
A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…
Q: Compare and contrast biochemical pathways. Describe the chemistry of the last three steps of the…
A: The citric acid cycle involves the oxidation of acetyl-CoA into CO2 and H2O. The beta-oxidation is…
Q: Please depict a noncovalent interaction important for the function of lysozyme
A: Lysozyme: An enzyme called lysozyme breaks down the polysaccharides in bacterial cell membranes.…
Q: 4. If the standard reduction potential for NAD+ to NADH is -0.320 V at pH 7 and the standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: A portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence.…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: true/false: The cofactor ATP is essential in all transamination reactions.
A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…
Q: Please explain this table (just the endothelial cell density)
A: Endothelial cells are a single layer of cells that lines all the blood vessels, lymph cells,…
Q: II. Draw the different forms of the following amino acids in solution. 1. Proline (3 forms) 2.…
A: Amino acids are basic unit of polypeptide chain. Alpha carbon of amino acids contains carboxyl…
Q: Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate using the enzyme…
A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: The structure of a metalloenzyme active site is down below(black picture). Describe, from a chemical…
A: Methane monooxygenase (MMO) is present in methanotrophic bacteria and MMO is present in an integral…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: High levels of glucose-6-phosphate inhibit glycolysis. If the concentration of glucose-6-phosphate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Report Table PP.7: Ninhydrin test Analysis of results for the Ninhydrin tests Glycine Tyrosine…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: DETAILS 09 Select all of the following half reactions that require energy (work) to proceed as…
A: The reactions that require energy to proceed are called endergonic reactions. The half reactions are…
Q: What is the main advantage of fluorescence polarization? Sensitivity of fluorescent probes Low cost…
A: FP is an analytical technique which provides information on orientation and mobility of…
Q: “The binding of oxygen to hemoglobin exhibits positive cooperativity.” Explain briefly
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: Upon doing the experiment of Protein Denaturation, what could happen in the precipitation of strong…
A: Denaturation is the disruption and unfolding of a protein, resulting in the loss of its biological…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Question 5 Which of the following subunits of ATP synthase is correctly described? a: site of ATP…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: Starch is a polysaccharide 1.Is starch positive in Bial‘s test？（what color ？） 2.Is starch positive…
A: Introduction: Polysaccharides are polymers of D-glucose that are joined together by glycosidic…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: Name the compound: 1. Lys-Ile-Met-Val Draw the forms of the amino acid in the solution. 2.…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Describe the four levels of protein in great depth. Desrcibe how protein structure may affect…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated…
A: The sequencing of DNA can be done using various approaches ranging from conventional Sanger…
Q: Electron transport chain. Complex 2
A: Electron transport is a succession of redox reactions, much like a relay race. It is a component of…
Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: The enzyme-catalysed conversion of a substrate at 25 °C has a Michaelis constant of 70 μmol dm and a…
A: The enzyme follows Michaelis Menton's kinetics. Kcat is the enzyme turnover number and it defines…
Q: Explain the regulation of biochemical pathways. Describe the regulation of β-oxidation. Describe the…
A: Beta oxidation is the catabolic pathway of degradation of fatty acids to release energy. Urea cycle…
Q: Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion…
A: DHFR fusion protein: The enzyme known as dihydrofolate reductase, or DHFR, reduces dihydrofolate to…
Q: Q11.3: What explains the observation that FADH2 oxidation yields one less ATP than NADH oxidation by…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: Which is CORRECT for the flow of electrons from NADH? NADH Complex I→ ubiquinone → Complex III →…
A: The electrons from NADH is transferred via a series of complexes to synthesize ATP. This is known as…
Q: Which of the following is the base component of the intracellular buffer? H₂CO3 HCO3 O H3PO4 O H₂PO4…
A: Buffers enable biological systems to maintain the pH within a particular range. Intracellular…
Q: Like other enzymes, arachidonic acid can be prevented from working by way of inhibitors. What…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Kinetic Parameters of Enzyme-Catalyzed Reactions TABLE 12-1 The Values of KM, Keat, and Keat/KM for…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: The PDH complex is a logical point of regulation in metabolism, as it links two major catabolic…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: I'm a bit confused for part c answer to this question, would it be possible to restate the answer…
A: PFK catalyzes the phosphoryaltion of fructose 6 phosphate to fructose 2,6 bisphosphate. PFK is an…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Identify the enzyme. catalyzes REDOX reactions catalyzes structural rearrangement of molecules…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Enzymes are classified…
Q: Which of the following is considered an omega-6 fatty acid?
A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…
Q: these lipids are soluble with dichloromethane? : olive, oleic acid, stearic acid, Lecithin, Vitamin…
A: Lipids are substances that are insoluble in water and soluble in organic solvents such as alcohol…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Introduction: An antagonist is a substance that does not cause any biological response itself but…
Experiment: DNA Extraction from Banana
The procedures are attached below.
Question:
1. Will the DNA you extracted be pure? What are the possible impurities?
Step by step
Solved in 2 steps
- 6. B. samples A and B in the tubes provided. Tube A B Using the spectrophotometer, perform DNA separation purity analysis of 260:280 ratio Mass of empty tube DI Water 2.80 Which of the samples (Tube A or B) represent values consistent with DNA contaminated with residual substances? Explain your rationale. Mass of water and tube 1.80 7. A. (p) 3 microcentrifuge tubes were labeled and the empty mass was recorded. DI water was added to each tube as noted below. The final mass of the tubes containing the water was recorded. Which tube represents the most inaccurate micropipetting? Tube 1 .280g 5uL .284g Tube 2 .280g 50uL .318g Tube 3 .280g 500uL .780gDNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at 4C or at room temperature. Longer spins make it difficult to resuspend cells. 2. Resuspend pellet in 100µl GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200µl NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150µl potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA. 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
- Indicate true or false for the following statements The glycerol used in the DNA loading dye allows DNA to be visualized under UV light. The DNA Ladder used for agarose gel electrophores can be used to estimate fragment size and DNA concentration. During gel electrophoresis a DNA smear may indicate that DNase was still present in the sample.1.00 Oc. Lyse the cells to release the nucleic acid P Flag O d. Break up the DNA question O e. Precipitate the DNA Question 3. The picture below shows the last step of nucleic acid extraction after the centrifugation step, the layer labelled A contains.. Not yet answered Marked out of 1.00 P Flag question Answer: Question In the experiment of amylase extraction from barely seeds, after the second centrifugation- the amylase enzyme will be found inDNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at FC or at room temperature. Longer spins make it difficult to resuspend cells. 2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…
- Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…. I 1 I 2 I 3. I 4. I 5. L . Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TIT ATG GAC TCT ACG GAC TAA CCC CCG TTT 3' 1. Synthesize a piece of DNA to complement the template: 2. Using the given DNA template synthesize the MRNA: 3. What is the amino acid sequence of this protein? Good to go O Focus(ACADEMIC) Time The solid matrix that is usually used to attach the target DNA in southern blotting technique is usually a O a. Polyacrylamide gel O b. Petri dish Oc. Cell culture plate O d. Membrane Oe. Micro-titer plate CLEAR MY CHOICE
- Results obtained from a Nano Spec. DNA samples collected: ng/uL A260/A80 A260/A230 E.coli genomic DNA 45.3 1.68 0.84 pEMBL1.9 26.0 1.80 1.09 pBluescript 82.1 1.90 1.89 What does this results tell us about the purity of the DNA samples? What are possible contaminations that may have occured?Samples/Enzyme DNA fragment(s) length 1. None 1500 2. ECORI 700, 800 3. BamHI 300, 1200 4. EcoRI and BamHI 300, 500, 700 А. Using the line below, draw a map showing the locations for each enzyme digestion site. Include distances. _1500 Use paper and draw more lines and try different combinations of cuts until you get the fragments with the right dimensions. Remember that I am asking to have resulting fragments long 300, 500 and 700 bps but they DO NOT have to be in that order.Which of the following conditions will affect the specificity of primer annealing? You may choose more than one answer. Annealing temperature Denaturation temperature Polymerization time _ [MgCl2]