Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…
A:
Q: 4. What is a suggestion you have for combating (or responding) to antibiotic resistance?
A: Antibiotic resistance is an acquired resistance pathogens get when they are treated with antibiotic…
Q: 12. The identification of bacteria by serolo gic tests is based on the presence of specific…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: How are methods of precipitating proteins, such as heat and treatment with alcohol, also successful…
A: Asked : Reason for heat and treatment with alcohol, also successful in killing harmful…
Q: 1. Explain why drinking saltwater causes diarrhea and dehydration.
A: Dehydration is a side effect of diarrhea, which is caused by contaminated water and food. Diarrhea…
Q: 4. When is it terminal to take an antibacterial after acquiring the bacteria?
A: Antibacterial are low molecular agents that will inhibit the bacterial growth .Since antibiotics…
Q: 2. List two types of probiotic bacteria (genus and species) and describe the health benefit(s) of…
A: Probiotic are live microorganisms (like bacteria, yeast etc.) which taken from outside as a food…
Q: 2- Explain in detail what are the three main controversies of he GMOS
A: GMO (genetically modified organisms) are those organisms whose genome has been altered by gene…
Q: 3. Label the following elements of the figure below: lysogenic phage, lysogenic cycle, lytic cycle,…
A: Introduction The lag phase, the log phase, the stationary phase, and the death phase are the four…
Q: 2. Define the term "Pharmacodynamics" and explain how this concept helps in the understanding of the…
A: Pharmacodynamics as the name suggests is related to the study of the effects that a drug has on the…
Q: 3. Why is it important to start a bacterial culture with a single, isolated colony?
A: A bacterial culture is the one which contains nutrient media required for the growth of bacteria.
Q: In what way does the use of antibiotics contribute to the problem of the emergence of drug-resistant…
A: Drug resistance is the reduction in the effectiveness of the drug in curing a disease called drug…
Q: Describe the key processes involved in vaccine manufacturing.
A: Vaccines are the ones where the microorganisms or antigens or any killer cells are killed or…
Q: 3. Explain about Bacteriological Methods of laboratory diagnosis?
A: Introduction A dichotomous key is a tool used to identify natural entities such as microorganisms,…
Q: Explain how do bacteria infect its host.
A: Bacteria (sometimes referred to as germs) are microscopic organisms that are invisible to the naked…
Q: are the adsorption mechanism of activated carbon on antibiotics? 3. What will happen to the…
A: Inside a cell, a biochemical process is the transformation of one molecule into another. Enzymes,…
Q: 1. If your body contains so many bacteria, why do they not make you ill?
A: Our body contains millions of microorganisms since birth to adult life . Majority of bacteria…
Q: 13) What is the purpose of a bacterium's cell wall? A) It provides direct protection from…
A: The bacterial cell wall is made up of a complex and mesh-like structure that is essential for…
Q: 3. Imagine that you are a researcher at a pharmaceutical company charged with developing new drugs…
A: Answer: ANTI-VIRAL DRUG = These are the chemicals used to treat the infection causing pathogens,…
Q: 5, What is an explant? A. Part of a gene in a DNA sequence B. A small piece of plant used in…
A: Tissue culture or micropropagation is a technique by which the number of plants can be grown at a…
Q: Discuss the characteristics of retroviruses. How do they act? How is their action different from…
A: Retrovirus are virus that has RNA as genetic material. When it infects the cell it first convert RNA…
Q: 5. Why is it important to use standardized antibiotic (ATB)-impregnated paper disks? What is the…
A: ATB (antibiotic) test is used to check the impact of a specific antibody on the selected bacterial.…
Q: 10) If the addition of an antibody raised against bacteria B, to a cell suspension mixture of…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: 6)Which of the following statements is a reason why Acid-Fast Bacteria resist the Gram stain a)…
A: Answer. Staining is a biochemical technique of adding a class-specific dye to a substrate to…
Q: . Why is the possibility that all antibiotics may become useless such a serious concern?
A: ANTIBIOTICS:- They used to treat infections caused by bacteria, so they are anti-bacterial and…
Q: 1) Which of the following apply(ies) to Bacillus cereus and Bacillus anthracis? Choose all that…
A: Bacillus is a genus of Gram-positive, bacilli, or rod-shaped bacteria. B. anthracis is the causative…
Q: Suppose you do the Kirby-Bauer test on a hypothetical Staphylococcus species with penicillin and…
A: Antibiotic sensitivity test is a test that is used to evaluate , which Antibiotic is best and most…
Q: 1. What are the characteristics of bacteria? What are the characteristics of viruses? Be specific in…
A: Typically, an accurate count of bacterial colonies is required for biological processes. Microbial…
Q: 1. How do pathogens use glycans to colonize and invade the host?
A: Glycosylation is a process of the addition of glycans to the cell surface to form a glycoconjugate.…
Q: Explain 2 of the 4 mechanisms of antibiotic resistance
A: Antibiotic resistance occurs when germs such as fungi or bacteria develop the potentiality to defeat…
Q: 1. Compare the three mechanisms of gene transferin bacteria: transformation, conjugation,…
A: Genetic engineering permits the genetic material (DNA) to be transferred between organisms moreover…
Q: How will you separate RNA from the aqueous phase?
A: ribonucleic acid is a kind of nucleic acid found in all living organisms. Its primary function is to…
Q: . Suppose you do the Kirby-Bauer test on a hypothetical Staphylococcus species with penicillin and…
A: Kirby-Bauer test is a disk diffusion test that is involved in determining the antibiotic sensitivity…
Q: Microbiology, are there technologies that can help make bacterial culture and sensitivity done…
A: The typical bacterial culture and sensitivity test takes around 7 days to give result, which can…
Q: 2.In a short paragraph give an example of the changes of human microbiota that result from medical…
A: Our body contains a significant number of healthy bacteria that are vital for the absorption of…
Q: Explain the concept of selective toxicity. How does it apply to the development of antibiotics?
A: Medicines known as antibiotics are used to treat bacterial infections in both humans and animals.…
Q: 1. In the Microbiology lab, staining methods are employed to appreciate the a. Shape and arrangement…
A: Bacteria are microscopic organisms which belong to prokaryote because these are unicellular…
Q: write in details about Resistant strain emergence to DNA inhibitors
A: Microbes, or viruses, are very microscopic living beings. While the majority of microbes are…
Q: 2. you do the Kirby-Bauer test on a hypothetical Staphylococcus species with penicillin and…
A: In Kirby-Bauer testing, bacteria are placed on a plate of solid growth medium and wafers of…
Q: 1. Explain the differences in the mechanisms of conjugation, transformation, and transduction.
A: Explain the differences in the mechanisms of conjugation, transformation, and transduction.
Q: 4. Describe how plasmids conferring multidrug resistanceto bacteria may have evolved.
A: A plasmid is small circular extrachromosomal materials present in bacterial or protozoan cells which…
Q: 1. If an antibiotic was able to destroy the pili of bacteria, what effect would you expect it would…
A: Role of pilus in bacteria One of the means of the defences against infection is the ability to…
Q: 8. The bacterium Staphylococcus aureus causes skin infections commonly called staph infections. One…
A: Methicillin Resistant Staphylococcus Aureus is a pathogenic strain of Staphylococcus Aureus which…
Q: 1. Give any (two) biotechnological products/process that was patented or coDvrighted in the…
A: The use of biology to make use of the living system and organisms to form products is called…
Q: How Did the Theory of Biogenesis Lead the Way for the Germ Theory of Disease?
A: The germ theory of disease is the theory that microorganisms are the cause of specific diseases, and…
Q: 9. Define adherence of the bacterial disease process. Why is this step so important for bacterial…
A: Note:Since you have posted multiple questions so we will be solving the first one for you. As per…
Q: 2. Describe the experiments done by Griffith that showed that material from dead bacteria could be…
A: INTRODUCTION The experiment done by the scientist Frederick Griffith on Streptococcus pneumoniae is…
Q: ive 10 negative and positive economic impacts of genetically modified organisms.
A: Definition: - Genetically Modified Organisms are organisms which have an altered genetic material…
Q: 3) What is the effect of time on the bacteriocidal effects of UV? The effect of distance?
A: The term bacteriocidal refers to the any compound, method or technique of prevention of growth of…
2. Explain how the overuse of antibiotics promotes resistance in a population of bacteria.
Step by step
Solved in 3 steps with 2 images
- Within six months of effectively using methicillin to treatS. aureus infections in a community, all new S. aureus infectionswere caused by MRSA. How can this best be explained?(A) A patient must have become infected with MRSA fromanother community.(B) In response to the drug, S. aureus began making drugresistant versions of the protein targeted by the drug.(C) Some drug-resistant bacteria were present at the startof treatment, and natural selection increased theirfrequency.(D) S. aureus evolved to resist vaccinesThere have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (vCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (vCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes vCJD. In spite of these numbers, the death rate from vCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. If you were traveling in Europe, would you eat beef? Give sound reasons why or why not.There have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (vCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (vCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes vCJD. In spite of these numbers, the death rate from vCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. What measures have been taken to stop BSE?
- My 90's TVI ID Moviehdkh - Club * HesGoal.Com Spor... Due Wednesday by 1:40pm Available after Oct 27 at 12:50pm Points 25 Submitting an external tool Attempts 0 Allowed Atte PINEDA, JUCL DO 8 of 25 3 4 6 7 8 9. 10 11 12 Fir In the 1880s, Louis Pasteur developed a method of weakening viruses. The weakened viruses could be injected into healthy individuals. How is this method effective in fighting viral diseases? O The immune system develops antibodies in response to the weakened viruses. O The rate of genetic mutation in the host is decreased due to the introduction of weakened viruses. O Weakened viruses are unable to enter the host organism. O The weakened viruses attach to unaffected viruses in the host and interrupt the viral reproductive cycle.Aminoglycosides inhibit protein synthesis in bacteria. These class of antibiotics are considered to be ___ . none of these choices effective only against gram-negative bacteria effective only against gram-positive bacteria broad-spectrum antibioticsHow hand sanitizer can help us to keep our hand clean especially during COVID-19 pandemic?
- Please answer with yes or no with correcting the falte statement. Felline to cottart the will cost the whole statements mark, 56) Prionsare small circular RNA Viruses, those viruses don't have capsid and they can't replicate in their own. They need & helper virus like hepatitis If virus to replicate 57) Car receptor can act as a receptor for multiple viruses, like adenoviruses and Herpesviruses. 58) For infiuenza viruses they enter the host cell via Clathrien-coated pits endocytosis; in which the cell receptors will be digested by the lysozyme enzymes 59) Uncosting is the removal of the outer capsid in order to release the genome to start the viral replication, In case of adenovirus the uncoalo appen.. membrane*what's contained in the flu vaccination*?The strain of Wolbachia from CalTech used in the infection experiments was nicknamed...? Zapper Zika Killer Рорсorn
- The worldwide spread ofmultidrug-resistant (MDR) pathogenicbacteria has becomean urgent threat to human and animalhealth. More than two million people inthe United States become infected withantibiotic-resistant bacteria each year, andmore than 23,000 of them will die fromtheir infections. In 2015, approximately480,000 cases of MDR tuberculosisoccurred worldwide and another 100,000cases were resistant to at least one antibiotic.In the United States, cases of drugresistantenterobacteriaceae infectionsincreased three-fold between 2001 and2012. In 2016, a woman in Nevada died ofa Klebsiella pneumoniae infection caused bya strain that was resistant to 26 differentantibiotics, including colistin, which is consideredthe “last resort” antibiotic.One factor leading to the spread ofMDR bacteria is the selective pressurebrought about by repeated exposure toantibiotics. Worldwide, livestock consume used as feed supplements. The routineuse of antibiotics in livestock feed and theoveruse of human…CAN Corynebacterium diphtheriae be infected by a viruses. I know it is a bacteria but I need to know if it is possible for it to be infected by a virus. Please be specific but in terms that is easy to understand. PLEASE answer this specif question. I don't need to know the causes, effects, outcomes, etc of Corynebacterium diphtheriae. I already know that stuff, I need this specific question answered. THANK YOU.This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids