Flagellate protozoans live in the guts of termites. The flagellates break down the cellulose that the termites eat, and both organisms benefit from the resulting nutrients. This relationship between protozoan and termite is an example of- mutualism parasitism equilibrium commensalism

Q: Contrast a bacterial flagellum with a eukaryotic flagellum.

A: Introduction :- Flagella are filamentous protein structures that can be found in bacteria, archaea,…

Q: 3. The immune system immediately attacks a transplanted tissue or organ, so transplant recipients…

A: Introduction :- Transplant rejection occurs when the immune system of a transplant recipient attacks…

Q: 1. Nutrigenomics is the study of how diet and gene expression interact throug molecular mechanisms.…

A: Epigenetic modifications are alterations in the genes without changing the exact or original DNA…

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: 24.2 The Life Cycle of a Flowering Plant 7. The photo is a cross section of a (an). The numerous…

A: Pollen grains are the male gametophyte of a flowering plant. These develop from microspores, which…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: 5. Larry and Lola Little have achondroplasia, a form of dwarfism. Both are heterozygotes. Their son,…

A: Heterozygous condition is defined as a condition in which two variations of a gene known as alleles…

Q: Draw the steps that take place during conjugation.

A: Bacterial conjugation is a process by which genetic material is transferred from one bacterium (the…

Q: 4. White fruit color in summer squash is dependent on a dominant gene (W) and colored fruit to the…

A: In this cross, the recessive allele of one gene masks the effects of either allele of the second…

Q: Two people are exercising at a gym. Person X notices a burning sensation in several muscles, while…

A: Introduction:- When an athlete exercises too hard, there isn't enough oxygen delivered to the…

Q: What is the label used in ELISA? Can we use different label? Why, or why not.

A: Answer

Q: What are the monoclonal antibodies: a) antibodies produced in one animal; b) antibodies delivered in…

A: Antibodies are specialised Y shape proteins that binds  to the foreign invaders -whether they are…

Q: Human Papillomaviruses has of many strains. Some of them cause warts while others can cause cancer.…

A: *Human papillomaviruses are type of viruses that causes abnormal tissue growth and cause other…

Q: What factors would contribute to preservation of DNA?

A: Introduction DNA preservation (also known as DNA banking):- It allows you to store some of your…

Q: Preserved remains of animals e.g. bones and shells are examples of trace fossils

A: Fossils are the remains, tracks, impressions, or evidence of ancient species. These are conserved…

Q: the plant 12. Imagine a potted plant growing by the bright window in your dorm room. Then you move…

A: Introduction Land plants are multicellular organisms that have a variety of properties that…

Q: How does gastrointestinal tract evade dehydration? Alternating wave-like contraction and relaxatio…

A: Q) How does gastrointestinal tract evade dehydration? Normal peristalsis movement in the large…

Q: Explain the mechanisms within organisms that protectthem from damage from toxic substances.

A: A toxic substance is a substance that is synthesised by plants, animals, microorganisms that have…

Q: Assuming that these are the 12 microplates. What is wrong with the result of the test? What do you…

A: There are few important points : ELISA : Enzyme linked immuno sorbent assay is used in diagnosing…

Q: times exercise intensity may be measured by all of the following except: xygen consumption eart rate…

A: Exercises makes a lot of changes inside the body. It makes changes in the way the heart beats and…

Q: For each of the following RNA molecules: Indicate if it is Required or Not for translation in…

A: Question) Indicate if it is Required or Not for translation in prokaryotes and, if it is required,…

Q: Analyze the roles of DNA repair, cell cycle control, and the immune system that play in cancer…

A: ANSWER;-

Q: lease answer the recent examples or studies about cloning of cells in: A. Animals B. Plants

A: Scientists use the process of cloning to produce same replica of living beings genetically. Cloning…

Q: Which of the following  would be the first step in biosynthesis of a virus with a - (minus) strand…

A: D. Synthesis of double stranded RNA from an RNA template

Q: What is the genetic potential of cloning Single genes in plants and animals?

A: There are few important points about cloning : We know that DNA cloning is the production of large…

Q: Marsupials

A: Mammals- an animal that breathes air, has a backbone, and grows hair at some point during its life…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: Presence of proximal and distal promoters in Drosophila melanogaster for alcohol dehydrogenase. Is…

A: Drosophila melanogaster is a species of fly in the family Drosophilidae. The species is often…

Q: 3. In poultry, a gene C produces creeper (very short legs) in the heterozygous condition and is…

A: CC genotype produces lethal condition. Cc produces creeper. cc produces normal leg.

Q: The capsid of a virus consists of (a) protein subunits (b) nucleic acid (c) helical lipids (d) a…

A: Introduction:- Virus is a small, simple infectious agent that can only multiply in live cells of…

Q: friend tells you the following story. "My aunt just received a heart transplant. Her doctors warned…

A: * Here a friend tells that his aunt received heart transplant and doctors warned her body might…

Q: 1. 2. 3. 4. 5. Most Recent Varieties STRAWBERRY Its Characteristics How It Was Developed

A: Strawberries are best planted in the spring as early as several weeks before the last prose date by…

Q: A urine sample with more than 100,000 organisms is considered indicative of infection. A urine…

A: Urine microscopy is a diagnostic tool used in diagnosis of various diseases such as bacterial…

Q: 1. Marsupials are unusual mammals because they carry their young in a oub. 2. Like most mammals,…

A: Marsupials are the members of mammalian infraclass Marsupialia.

Q: Q4/ What is Osteoporosis disease? Explain the pharmacist role in giving the suitable prescriptions…

A: Across most vertebrate animals, a bone is a hard organ that is part of the skeleton. Bones protect…

Q: The science of producing and transmitting sound waves in materials has become widespread with many…

A: The ultrasonic waves have good propagation in the human body. Thus, it have been widely applied in…

Q: 39. the mouse REST gene is under the control of a promoter region which contains alternative…

A: Alternative promoter is an alternative region from which the transcripts of a gene originate. The…

Q: FUNGI ACTIVITY breakdown of decaying matter recycling of nutrients Form beneficial relationships…

A: Fungi are a group of organisms that can be unicellular or multicellular. These feed on organic…

Q: The closest living relatives of hagfishes are_____ . a. snakes c. lampreys b. sharks d. placoderms

A: The organisms that has a common ancestor can share a relativity of closeness among it. These…

Q: a. 5 Ends b3 Ends c. Hydrogen Bond d. A Nucleotide e. Deoxyribose Sugar f. Phosphate 9. Each base…

A: DNA is also known as the oxy ribonucleic acid. It is present in all the prokaryotes and eukaryotes…

Q: 12Bacterial growth can be measured a.   Directly by counting bacterial cells   b.   Indirectly…

A: Introduction The bacterial cell cycle entails the replication of DNA and the partitioning of…

Q: Which of the following statements BEST explains the relationship between the parts of genetic…

A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…

Q: the diploid somatic nucleus of xenopus has 900 copies of rDNA and in the mature oocyte it could…

A: Transcription is a process in which DNA is converted to RNA.

Q: Turtles, lizards, and birds belong to one major lineage of amniotes, and_______ belong to another.…

A: Introduction:- Amniotes are vertebrates that grow their embryos in a sac called an amnion. A…

Q: 4During the multiplication of a bacteriophage in its host cell, the specific viral growth phase…

A: Viral replication has 7 stages: Attachment Penetration Uncoating Replication Assembly Maturation…

Q: ос О А Ов No answer text provided.

A: Several post-translational changes of nucleosomal histones' amino-terminal tails can impact…

Q: Please answer fast and all 1. Outline how external environmental factors can affect the stability…

A: Lichen is a symbiotic relationship between algae and fungi. Algae prepares its  food for itself and…

Q: What feature do plasmodesmata have? What function do they have in plants?

A: Plasmodesmata are intercellular pores that connect adjacent plant cells, permitting membrane and…

Q: ndustrial effluent from a metal processing factory released Cu into a nearby river without any…

A: Introduction The act of observing and measuring the state and continuing changes in ecosystems,…

Q: different kinds of waste produced in a Nuclear Medicine Department.  What are the appropriate…

A: Nuclear Medicine Department The nuclear medicine department is that branch of science and medicine…

Ecological Interactions

The study of the ecological interactions between living beings and their physical environment, including humans, is ecology. It aims to understand the crucial links between plants and animals and the world around them. Ecology also gives knowledge on the advantages of ecosystems and how we may use Earth resources to ensure that future generations have a healthy environment.