Q: What vaccines are available to prevent viral hepatitis?
A: Introduction Hepatitis virus as the name suggests affects the liver, Hepatocytes, and itis means…
Q: Name the respiratory centre found in Pons that is responsible for increasing the breathing rate.
A: Pons It refers to the part of the brainstem that lies inferior to the midbrain, anterior to the…
Q: Several calibration curves were created for a series of protein standards of known molecular mass…
A: Introduction :- Chromatography is a laboratory method used in chemical analysis to separate a…
Q: Define the normal age range for the onset of puberty.
A: When a boy or girl reaches puberty, they reach sexual maturity. It results in bodily changes and…
Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…
A:
Q: What immune mechanisms are operative in glomerulonephritis?
A: Glomerulonephritis is minor inflammation in the glomerulus. It may be acute or chronic. It also…
Q: Explain the term first-pass eject or hepatic metabolism of the drug. What effect does first-pass…
A: Introduction:- Drugs are the form or a type of medicine which are used to treat different types of…
Q: 1. What were the clues that led to the identification of the suspect? 2. What do you think the…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Are the Sweet potato and Potato homologous or analogous? What type of evolution has brought such a…
A: Introduction : In biology, evolution is the alteration in a species' traits over a number of…
Q: A.) Answer the following questions: 1. What is an ecosystem? 2. Identify the different types of…
A: Introduction Ecology is the study of interactions between living things, such as humans, and their…
Q: Explain the following areas about (Types of laboratory devices) 1. Who makes up the device or what…
A: The study of biology is a broad area of study. Scientists continually learn new things about the…
Q: How does breast development differ between adult men and women?
A: Introduction Humans belongs to class Mammalia. Means they have mammary glands to feed their young…
Q: Name the two functional divisions of the vertebrate nervoussystem, and describe how they interact.
A: Introduction The nervous system is the main controlling center of the body which controls all…
Q: Give examples of how the study of living materials requiresan understanding of chemistry.
A: Every matter is composed of elements or molecules. Molecules are composed of atoms and atoms are the…
Q: One thousand Ca2+ channels open in the plasma membrane of a cell that is 1000 μm3 in size and has a…
A: The passage of ions through the cell membrane takes place depending on the concentration of the ion…
Q: Sketch the abdominal area, and indicate thelocations of the following regions:a. Epigastric b.…
A: The human body has a symmetrical symmetry and thus is divided into head thorax and abdomen.
Q: What is the function of the gallbladder?
A: Introduction The human digestive system comprises the alimentary canal and associated digestive…
Q: 1) Compare the different hierarchical organizations and/or animal body plans across different…
A: All biological systems are made up of subsystems of various orders that are part of larger…
Q: The eight climographs show yearly temperature (line graph and left vertical axis) and precipitation…
A: Introduction Long-term changes in temperature and weather patterns are referred to as climate…
Q: list three main ways that the bonobos differ from common chimpanzees, and one way they are similar.
A: The changes in the heritable characteristics of biological populations over successive generations…
Q: What does the term "lentivirus" mean? OA virus that inserts its DNA into the host's DNA Oa virus…
A: Introduction: Lentivirus is any of a group of retroviruses that produce illnesses which is…
Q: Explain how mutations in the following proteins might result in either loss of responsiveness to a…
A: A mutation refers to the alteration in the nucleotide sequence of DNA. It is caused by physical,…
Q: The controlled exposure condition applies to the general public with no time restrictions. Select…
A: Controlled exposure means exposure to various ionizing radiations that include X-rays, gamma rays or…
Q: Discuss the new hypothesis for pathogenesis of ovarian cancer.
A: Ovarian cancer is the most common cause of death from gynecologic malignancies in the United States.…
Q: In 1956, two Corsican mouflon sheep were introduced to Haute Island, which has an area of 7.00 km².…
A: Introduction In reality, there are no unlimited resources that allow unrestricted population growth.…
Q: Determine the advantage of regulating the binding of RNA polymerase to DNA at the promoter.
A: The synthesis of RNAs and proteins in accordance with the instructions contained in deoxyribonucleic…
Q: Why does amenorrhea occur?
A: Menstrual period refers to shedding of the thickened uterine wall along along with unfertilized ovum…
Q: Assuming the technology and expertise is ready and available, which specific human/animal/world…
A: Introduction Unlike eukaryotic cells in plants and animals, prokaryotic cells such as bacteria…
Q: Q6 - How many individuals are heterozygous? How many are homozygous ? Q7 - What is the probability…
A: NOTE: sorry, please note that some data (actual question) is missing for Image 2.Please repost Image…
Q: List the four most abundant elements in thehuman body
A: In the human body, four elements are present in high quantity. More than 99 percent of elements are…
Q: In cats, Manx (M) is a dominant allele that results in cats lacking a tail. The recessive allele (m)…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: 4. Tabulate the similarities and differences between an acidic and basic buffer solutions
A: When a little amount of acid or base is diluted or added, the buffer solution undergoes only slight…
Q: basal metabolic rate and standard metabolic rate.
A:
Q: identity the slides with labelling and also mention the important features of this slides
A: Cryptococcus neoformans is a species of small encapsulated yeast that has the ability to cause mild,…
Q: Humans need food to provide energy. What other necessary component does food provide for the body? O…
A: INTRODUCTION The necessary components food provides to our body is briefly explained below.
Q: Which best describes conjugation in bacteria? OA. Bacteria take DNA from their environment. B.…
A: Gene transfer is the movement of genetic information between organisms. It can be horizontal or…
Q: Expla (MRI device) 1. What are the ingredients? The device? 2. The working principle 3. What common…
A: MRI stands for magnetic resonance imaging. Magnetic Resonance Imaging (MRI) is a non-invasive…
Q: 2. Determine whether the event takes place during INHALATION or EXHALATION. _____1. The diaphragm…
A: Inhalation and exhalation are how your body brings in oxygen and gets rid of carbon dioxide.
Q: The expression levels for two genes measured at four times are: Compute the correlation…
A: The correlation coefficient's size reveals the degree of the link. A correlation of r = -0.2…
Q: 1. In a four-legged animal, which of the following terms is synonymous with anterior? A. Ventral…
A: Note:- according to bartleby guidelines i can answer maximum one question or the three sub parts of…
Q: Where does the TPC diverge from the SPEC in terms of focus?
A: TPC or Transaction Procession Council is an organization that standardizes benchmarks for relational…
Q: 1. Put the following in the correct order and describe each pattern of disease : period of…
A: The disease is a condition in which normal structure and function of the body are impaired or…
Q: A culture is growth of microorganisms in a special
A: Nutrients are substances used in biosynthesis and energy production and therefore are requirea for…
Q: concise timeline of events that happened in the early history of developmental biology
A: The branch of science that is responsible for the studies into various process that aids in the…
Q: How do the number of fatalities related to heat waves compare to the number of deaths caused by…
A: A heatwave is a period of extreme heat accompanied by high humidity, especially in countries with a…
Q: Why does puberty occur too late or too early in some individuals?
A: Puberty is a crucial stage in human development, marking the transition from childhood to adulthood.…
Q: Capillaries are ideal for separatin Mark ALL that apply:
A: Note: As per the guidelines we will be answering one question at a time. Please repost the other…
Q: . Write complete sentences using each of thefollowing terms to correctly describe the…
A: The science of nomenclature involves giving organisms names. The names are distinctive and…
Q: If the following cross occurred AAbb x aaBB, what is the probability of getting an offspring that is…
A: Introduction Alleles are the hereditary units on the chromosomes that control specific traits or…
Q: What has been successful in previous attempts for weight loss?
A: Being overweight has an adverse impact on the health of a person as it can invite various diseases…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
For this RNA code, what is the final codon ?
UACACGCCAGAGGUCGCCUUUACA
Step by step
Solved in 2 steps
- What is the start codon? What are the stop codons? Do any of them code for amino acids?Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GHow many open reading frames are present in the following mRNA sequence? You may find the codon table helpful. 5' AAUGGGAAUUCCCGAUGAAUAUAATCGTCCTGCATUGAUGGUCCAUGCAAGU 3'OH
- What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUThe codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’