From the list given - choose all the regulatory sequences that you thỉnk would control the expression of this eukaryotic gene enhancer sequence O mediator protein PPE sequences O DNA-bending protein 5' UTR core promoter 3' UTR O coding sequence O introns
Q: Where does the Holobiant fit on the tree of life? One's with many eyes (when sensitive introverts pr...
A: Natural selection can also give certain people a reproductive edge over others. Natural selection wo...
Q: New flu strains can arise by______ . a. meiosis c. viral reassortment b. mitosis d. binary fission
A: Introduction:- Influenza The features of the hemagglutinin (H or HA) and neuraminidase (N or NA) sur...
Q: an egg cell were treated with EDTA, a chemical that binds to calcium ions: The acrosomal reaction wo...
A: Physiologically, the acrosomal reaction requires presence of calcium ions for the reaction to happen...
Q: Discussions on crime and deviance suggest that biological explanations of crime are superior to all ...
A: Eugenic movement deals with the genetic construction of an individual. With the theory of Cesare L...
Q: Which is a better indicator for Salmonella - coliforms or E. coli?
A: Introduction: Salmonella typhi is a genus of rod-shaped bacteria that is responsible for typhoid. Ea...
Q: The energy used to make ATP via oxidative phosphorylation is from a(n) (Select one answer from list...
A: Oxidative phosphorylation is the process in which ATP molecules are produced in mitochondria through...
Q: Describe the method of preparation of planting material for Ginger and describe how it can be propag...
A: Introduction Ginger (Zingiber officinale) is a plant native to Asia, it is a flowering plant whose r...
Q: 2 Nerissa has 5 pink bows, 1 blue bow, and 4 purple bows in a box. She will randomly choose 1 bow fr...
A: ANSWER;- G 2/5
Q: The three phases of the photosynthetic dark reactions are ond
A: * Calvin cycle is called as dark Reaction as thick cycle is main pathway for dark reactions. *The da...
Q: A bacteriophage λ is found that is able to lysogenize itsE. coli host at 30°C but not at 42°C. What ...
A: Introduction Viruses have two types of life cycles either the Lytic cycle or the Lysogenic life cyc...
Q: Differentiate species diversity, genetic diversity, and ecosystem diversity.
A: Biodiversity is a vast term including a variety of organisms living together in an ecosystem. Biodiv...
Q: A mutation that inactivates the repressor gene of the lac operon results in (a) the continuous trans...
A: In bacteria and their viruses, an operon is a genetic regulatory structure in which genes coding for...
Q: 10. About 70% of Americans get a bitter taste form the substance called phenylthiocarbamide (PTC). I...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: What levels caused the diversification event?
A: Diversification is a phenomena in which good number of new species formed by making changes in the ...
Q: A zoologist is studying a deer and found out that a gene is located on autosome two. This gene contr...
A: The genes are located on the particular locus of the chromosome. An organism contain autosomes and s...
Q: Why will a mother bird abandon its chick if touched by a human?
A: Birds (Aves) are a group of animals that evolved from dinosaurs and have backbones. They are dinosau...
Q: The capsid of a virion consists of_____ . a. DNA c. protein b. RNA d. lipids
A: Introduction We are surrounded by various pathogens such as bacteria, viruses, fungus etc. Every da...
Q: Ginger
A: Ginger is a flowering plant whose rhizome, ginger root or ginger, is widely used as a spice and a fo...
Q: Compare the types of bacterial genes associated with inducible operons, those associated with repres...
A: Gene regulation is a collection of mechanisms that the cell employs to reduce or increase the produc...
Q: How many ATP's are formed per molecule of NADH and FADH2? How would a different number of subunits i...
A: ATP also called adenosine tri phosphate is the energy currency of the cell and stores energy in the ...
Q: Give the most currently used methods in the identification and classification of archaea.
A: Archaea are a distinct group consists of single celled organisms which have distinct molecular featu...
Q: How can growth in aquaculture result in a proportional increase in disease problems? Explain compreh...
A:
Q: Based on your observation and knowledge, what is the most important problem faced by the human being...
A: The most important problem faced by society is mental health in an increasingly isolating and aliena...
Q: The theory of evolution is supported by a large body of evidence. First is the occurrence of #1 foun...
A: The evolution of life on Earth does not only about the extinction of one species and the emergence o...
Q: Differentiate motor nerve ending and sensory nerve endings? Explain briefly and be direct to the poi...
A: The nerves which carry information from Central Nervous System(Brain and spinal cord) to Peripheral ...
Q: Compare Darwin’s description of natural selection asquoted on page 765 with Wallace’s description of...
A: Darwin and Wallace recognised that a particular species' population at any given moment contains ind...
Q: . Which amino acid has a polar side chain? . Which amino acid is more soluble in water? B . Select t...
A: The building blocks of life are the cells. These cells are the structural and the functional units o...
Q: Citric acid production: Anaerobic fermentation is used to produce citric acid from glucose derived f...
A: Citric acid is the most widely used reagent in many biological and chemistry in vitro reactions Ana...
Q: Give the properties of Coronavirus as an immunogen.
A: Coronavirus (specifically SARS-CoV-2) is a potent immungen which elicits a strong immunological resp...
Q: The CDC estimates 20 million new cases of sexually transmitted infections (STIS) in the United State...
A: Sexually Transmitted Infection (STI) is an infection transmitted through sexual contact, caused by b...
Q: A female friend tells you that her doctor is suggesting screening for Human Papillomavirus (HPV). Do...
A: INTRODUCTION Human papillomavirus Human papillomavirus cause sexually transmitted diseases. Commonly...
Q: Define about X-gal (technically 5-bromo-4-chloro-3-indolyl-b-D- galactopyranoside) ? Explain importa...
A: Introduction In the RDT (recombinant DNA technology), we insert the segment of DNA into the vector ...
Q: Why are coliforms better indicator of salmonella rather than E. coli?
A: It is considered that Salmonella is best detected by coliforms rather than E. coli. The reason is de...
Q: Which of the following is a type of evidence that DARWIN used to support the idea of common ancestry...
A: Introduction: Evolution is the change in the inherited characteristics of biological populations ove...
Q: Differentiate a native species, endemic, introduced, and invasive species
A: Species is the basic unit of classification. On the basis of where the species has originated and wh...
Q: Describe how a gene might be deleted in a zygote using CRISPR/Cas9 editing.
A: CRISPR, which stands for "clustered regularly interspaced short palindromic repeats," is a type of s...
Q: How can we differentiate so many different foods if we can only taste four flavors on our tongue: sw...
A: Introduction In this question we will discuss how we can differentiate so many different foods if we...
Q: 1. Please examine the character matrix below:. Traits | $ * | 7 1 2 3 4 5 6 7
A: Evolution means change. It is the study of origin of life. A phylogenetic tree is used to depict ev...
Q: How long does it take for the sample sponge to dissolve in bleach? How will you describe the dissolv...
A: 1)Sample sponge , porifera takes 5 min to be dissolved in bleach and after dissolving the sponge tis...
Q: Some bacteria are able to use anaerobic respiration. What does this mean and how does it work?
A: Anaerobic respiration is an important process for bacteria that live in low-oxygen environments. It ...
Q: Calculate the number of ATP's formed in the liver from the complete metabolism of one molecule of gl...
A: A molecule found in all living cells that provides energy for a range of metabolic processes as well...
Q: What general measure/s can you recommend in order to prevent the majority of the parasitic and funga...
A: a) Providing water sources free of pathogens. b) Protection from the transfer of pathogens. c) Dis...
Q: 2009 Question #1: Describe how a plasmid can be genetically modified to include a piece of foreign D...
A: A plasmid is a short, circular bit of DNA that differs from chromosomal DNA, which contains all of a...
Q: What's the correct answer and why? I'm confused on how lacZ expression works.
A: Lac operon is a group of genes with single promoter. The genes in the operon encode proteins that al...
Q: Research other mutations in the TAS2R38 gene and how they may influence bitter taste perception.
A: Taste sensitivity plays a central role in individual dietary behaviour. Differential taste sensitivi...
Q: Ginger undergoes three (3) stages of Growth. Name and describe the these stages from Germinating sta...
A: Introduction:- Ginger is a perennial herb. It is used as a spice in many dishes. In Ginger Gingero...
Q: male having genotype AaBbCC mates with a female having genotype aaBBcc.
A: The fork line method can be used by figuring the occurrence of each gene or set of genes to be found...
Q: Explain the manipulation of newly created recombinant DNAmolecules ?
A: Introduction Gene cloning is the technique to produce the exact copies of the desired gene by utili...
Q: II. Solve the following problems. 1. Mendel crossed a plant that was heterozygous for height and het...
A: Introduction: • The physical appearance of an organism such as colour, height, which occurs as a res...
Q: What is a recessive gene?
A: Gene is the fundamental unit of heredity. Alleles are contrasting traits of a gene.
i need help finding the right answers to the queshtion
Step by step
Solved in 2 steps
- PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSMolecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’sThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
- The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omissBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- Predict the amino acid sequence produced during translationof the short theoretical mRNA sequences below. (Notethat the second sequence was formed from the first by a deletionof only one nucleotide.) What type of mutation gave rise tosequence 2? Sequence 1: 5'@AUGCCGGAUUAUAGUUGA@3' Sequence 2: 5'@AUGCCGGAUUAAGUUGA@3'During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, IICanvas Question 5 Select any of the choices that would be considered a post-transcriptional modification of pre-messenger RNA. (multiple answers expected)] O Addition of a 5' cap O Addition of a 3' poly-A tail O Removal of introns O Ligation (joining) of exons Question 6 Select any of the statements that could describe a gene mutation. [multiple answers expected] O a change in the DNA sequence of an organism O may be caused by changing the identity of a base O may arise spontaneously O may be caused by losing or adding a nucleotide hp