Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate the mRNA into codons (3 bases). Step 3. Using the newly made mRNA, translate it into its corresponding protein fragment. Refer to Figure 1 (The Genetic Code Table). Don't forget to look for the start and stop codon.
Q: Does blood type influence COVID-19 symptoms? Research regarding variable presentations of COVID-19…
A: Introduction The presence and absence of antibodies and hereditary antigenic compounds on the…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity,…
A: RNA polymerase is an enzyme which is responsible for the transcription process, that takes place in…
Q: In discussions of feedback in biological systems, negativefeedback is typically emphasized, and…
A: A negative feedback system is one in which the change is opposed so that homeostasis is retained
Q: xamine the pedigree. If individual I-1 is a carrier for the Robertsonian translocation leading to…
A: Down syndrome is characterised by a combination of phenotypic features that include mental…
Q: What do you call the larvae of echinoderms? Also, reptiles are cold-blooded vertebrate, how do they…
A: Introduction : Echinoderms are animals that are invertebrates. The name actually means spiny skin!…
Q: How many colonies are present in this plate?
A: Microbiology is the study of microorganisms and associated topics. Microbiology has gone a long way…
Q: Knockout mice are mice in which certain genes are rendered irreversibly nonfunctional through the…
A: The knockout mouse has been a valuable tool for geneticists to discern the role of a gene in…
Q: How do we know that collagen is required for tissue integrity?
A: Proteins are large, complex molecules that perform numerous important functions in the human body.…
Q: What can you do with a closed ecosystem in a container's habitat to create more biotic niches?
A: The ecosystem is made up of biotic and abiotic variables and interactions between these two factors…
Q: Genotype and environment interact to produce the phenotype ofan animal. Explain comprehensively the…
A: Genetic traits are regulated by genes.
Q: Critical analysis on usage of face masks in COVID-19 pandemic – benefits vs. disadvantages Benefits…
A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…
Q: Karner blue caterpillars are: A protected by ants B fed by ants C attacked by…
A: Mutualistic, commensalistic, or parasitic symbiosis is any sort of comprehensive and long ecological…
Q: 2. In a common eudicot pattern of development for the common bean in the figur the seed (1), then…
A: Various environmental factors have a significant role in the germination of a seed. Hence the study…
Q: According to the __________ perspective, physicians rose to dominance in the American health care…
A: Healthcare industries has taken a great initiative in many perspectives. Moreover with the…
Q: With your understanding now about vitamins, is it recommended to take any supplemental vitamins in a…
A: Introduction A vitamin is an organic molecule that is an essential micronutrient that our bodies…
Q: What are MHC class I and class II receptors and how do they recognize foreignness? This is an…
A: MHC (Major Histocompatibility complex) is a type of transmembrane glycoprotein which are presented…
Q: Which of the following illustrates the regulative nature of early mouse development? (a) the mouse…
A: The mouse has been used as a model organism to study the development of mammals.
Q: how does planting of native trees support biodiversity and ecological stability?
A: In 1985, the word "biodiversity" was coined. It is essential in both natural and manmade ecosystems.…
Q: What are the concepts behind osmosis and enzymatic browning in potatoes?
A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…
Q: A true breeding tall plant was crossed to a dwarf plant. Tallness is a dominant trait. The F1…
A: We will answer the first three subparts. Please submit the rest parts again in order to get the…
Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…
A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…
Q: Explain why monarchs have different survival probabilities in species A and B
A: The monarch butterfly and natural milkweed plants have a symbiotic relationship. Monarch butterflies…
Q: we read that in tumor cells Rb protein is hyperphosphorylated. In response to that, will p53 level…
A: Phosphorylation leads to interdomain locking, which alters the structure of pRb and inhibits it from…
Q: 6. List the Kingdorm, Phylum, Class, Order, Family, Genus and Species names for human beings.
A: in this question how human beings are classified ask.
Q: What is the basic principle of GPC (gel permeation chromatography)?
A: Gel permeation chromatography is a type of size-exclusion chromatography that uses organic solvents…
Q: Describe Class I MHC pathway of antigen processing and presentation. Highlight the functions of the…
A: The process by which foreign antigens are displayed on MHC, or major histocompatibility complex…
Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…
A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…
Q: Question:- Why is the population in decline over much of the fragmentation spectrum, even in…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: In WBC test, what low numbers mean? For example, 2,000 * .cells /mcL Dietary deficiencies Allergies…
A: White blood cells, which are part of the immune system, are produced in the bone marrow. White blood…
Q: How is the mechanism for a nuclear-encoded protein when is targeted to the thylakoid membrane
A:
Q: When our own enzymes begin to break down our own cells this is known as: Group of answer choices…
A: * Decomposition the process in which dead organic substances are broken down into simpler inorganic…
Q: name of the cellular receptor that hemagglutinin binds to ?How does Influenza enter the cell once it…
A: Influenza Is a viral infection that targets the respiratory tract of humans (mainly the nose, throat…
Q: During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order to
A: This topic is based on transcription bubble.
Q: is the energy also being cycled in the ecosphere like the matter or is energy being added to the…
A: A group of living species and their abiotic (non-living) surroundings is referred to as an…
Q: When does DNA replication occu after the cell divides O before protein synthesis O during cell…
A: Cell cycle is the series of cell division that takes place in a cell as it grows and divides. Cell…
Q: A
A: Introduction Muscles are soft tissues that contract to produce a particular movement, fascicles are…
Q: If you were to find 60-million-year-old fossils of a species of land plants on the east coast of the…
A: Fossils are the substances that are used to give us information about how animals and plants were…
Q: You live in a community with cell sites (or cellular-based stations). You ther thinks that this…
A: INTRODUCTION Cell sites or cellular-based stations are defined as a set of equipment that is needed…
Q: on 15 aryotic transcription enzymes will synthesize small nuclear RNA molecules involved in the…
A: 15. True
Q: A cell that is undergoing meiosis started 6 chromosomes. At the end of meiosis I: 1. How many cells…
A: Meiosis is a process in which a single cell divides twice to produce four cells with half the amount…
Q: What is the following molecules not required for DNA synthesis during S- phase? * O RNA primer…
A: DNA replication is the process by which new DNA is synthesized from the old DNA. In case of…
Q: Individuals with the hereditary disorder ataxia telangiectasia suffer from neurodegeneration,…
A: Ataxia-telangiectasia is a genetic disorder caused by a point mutation in the ATM gene.
Q: Vhich of the following are required to set up a CRISPR-Cas9 experiment to fix a mutation in a gene…
A: CRISPR or Clustered regularly interspaced short palindromic repeats is a gene editing technique in…
Q: What is the effect of increasing the concentration of lactose in the action of the enzyme lactase?…
A: Lactase Lactase is a enzyme with digest lactose present in milk or in any solution. It break…
Q: List and describe the events that take place (and the structuresinvolved) between excitation of the…
A: Skeletal muscles require stimulus from motor neurons for contraction.
Q: uestion 15 aly eukaryotic transcription enzymes will synthesize small nuclear RNA molecules involved…
A: Transcription is the process in which RNA is synthesized. The main transcription enzyme is RNA…
Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…
A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…
Q: Which domain of the DNA polymerase has a role on correcting the position of the primer and the…
A: Introduction A domain is a specific physical region or amino acid sequence in a protein that is…
Q: What is chromosomal formation called? 2b. When specifically was it formed? 3c. Would it be found…
A: * chromosomes are the structures found in nucleus of cells with long pieces of DNA. *DNA holds genes…
Q: In the cells of patients with I-cell disease, their newly synthesized lysosomal proteins are not…
A: All organisms are made of numerous cells. Aptly cells are the building blocks of an organism. Cells…
Pls Provide what is being asked in the picture given
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedC. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for analysis and writing your answers) PERFORMANCE TASK-SAY IT WITH DNA: PROTEIN SYNTHESIS Directions: 1. Build the correct mRNA molecule by transcribing the template DNA strand. 2. Figure out the TRNA triplets (anti-codons) that would fit the mRNA triplets (letter by letter). 3. Translate the MRNA codons and find the correct amino acid using the Codon Wheel on page 1. 4. Write in the amino acid (abbreviation) then, record the one-letter symbol of the corresponding amino acid. If you do this correctly, the symbols should spell out a meaningful message in English. Note. "Stp" = "space" (no equivalent symbol, leave it blank) MRNA DNA -> TRNA T А U G A -> A -> Here is a partially solved message... Decode the rest of the message. TT CTT DNA message code CTT | GGG ACT TAG AGC ATT CCT GCC CTT CGA TGC MRNA CUU AUC UUU GAA UGA AUC TRNA GAA UAG AAA CUU ACU UAG Amino Acid abbr. (based on MRNA) Leu Ile Phe…Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
- Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know. Remember, what pairs with A? With C? DNA sequence: ACСА СТА ССТ СТС АТT MRNA sequence: UGU GAU Directions: Now use the codon chart to translate the mRNA sequence into an amino acid chain. Second letter A G UUUPhe UAU Tyr UCU UCC UCA UCG UGU UGCCYS UAA Stop UGA Stop A UUC UAC Ser UUA UUG Leu UAG Stop UGG Trp G CAU CGU] CUU CUC CUA CUG CCU CCC CCA CCG His CAC CAA Gin CGC Leu Pro CGA Arg A CAG CGG AAU Asn ACU ACC ACA AUG Met ACG AGU ser AGC AGA Arg AUU AUC Fle AAC Thr AUA AAA AAGLYS AGG. G GGU GGC GCU) GAU GUU GUC GUA GUG GAC Asp GAA GCC Ala GCA Gly Val GGA A GCG Glu GGG GAG, Amino acid sequence:Cys + Asp First letter Third letterQuestion Completion Status: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base U C G Phe Ser Тyr Тyr Stop Cys Cys U Phe Ser Leu Ser Leu Ser Stop Trp Arg. U Arg Arg Arg Leu Pro His Leu C Leu Pro His Pro Gln Leu Pro Gln lle Thr Asn Ser U A lle Thr Asn Ser lle Thr Lys Arg Arg Met Thr Lys Asp Asp Val Ala - Gly Gly Gly Gly Val Ala Val Ala Glu Val Ala Glu A. Transcribe the DNA sequence TACTAAACACCGATT into mRNA (do not include any spaces in your answer): B. Where in a Eukaryotic cell does the process in part A take place? C. Translate the mRNA sequence from above into the amino acid sequence (in your answer, use the 3 letter abbreviations from the table above, and separate each amino acid with a space): D. If a molecule of DNA contains 22% thymine, what percentage of cytosine would it have? Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All An First Base DCAGD CAGUCAGUCAG Third Base
- Modified True or False: Write TRUE if the statement is correct, if the statement is false, change the word/ words in (parenthesis) to make it correct 1. Between the two strands of a DNA segment, the nitrogen bases are held together by (phosphodiester bond). 2. When the ribosome encounters (UAG) in the mRNA it will terminate translation. 3. (mRNA) moves from the nucleus to the cytoplasm prior to translationThird letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCGACTIVITY: Transcribe mel A. Below is a DNA sequence. Write the sequence of MRNA codons that would result from the transcription of the DNA sequence. 4 CTT 6. ACG 7 GGG 8 AAC 10 ATT DNA: ACA ATA TAG TTG CC MRNA: B. Rewrite your mRNA sequence from part A. Using the amino acid chart, determine the sequence of amino acids based on your mRNA strand. Use hyphens (dashes) to separate amino acids. mRNA: RNA:
- Final Assessment for Exploring M X forms/d/e/1FAIpQLSe8RrfvHEr59pISGjbEneL041GxKTvyw9-Xc_EA7Um_8xqReA/viewform?hr_submission-Chg1990yzQ8SEAjwvY285... First mRNA base (5) end of codon) A Sequence C Sequence D 5. A DNA sequence of "ACG" will code for the amino acid UUG CUC CUA CUG wh GUC GJA GUG Cys 100 AUU AUC lle ACC AUA ACA AUG MACG] Val M Second mRNA base UCA UCG The GCU GCC.. GCA GIGA CAA CAG Tyr UAC UGC UAA Stop UGA Stop A UAG Stop UGG Tro AAU AAC MT AAC GAC GAG 2 Lys Asp CGA CGG AGU AGC AGA AGG Lys GGU GGC GGA GGG Arg DUAU Gly C Third mRNA base (3' end of codon) Lys (K) DELL C GU A C DEOTOCCAGUCAGUCAGUCHOSOTOS M G (F) A (LS1-1) * GU A C CUGA OPCUGACU GACUSACCO AD A G OCO Trp (W) \u« 9799%3Fo 33 4(2/וt/ MODULE 11B- Transcription and Translation handouts Transcription and Translation Practice Worksheet nie For cach of the following sequences, fill in either the DNA, the mRNA sequence, the tRNA anticodons, or the amino acid scquences that have been left blank. If several sequences might work choose any one. ang IAC TGA TCG ACC ccc ATA ATG AAA ATC 1. DNA AUG ACU AGC UGG GGG UAU UAC UUU UAG MRNA unc uGA ucG ACc ccc AuA AUG AMA AUC (RNA AA 2. DNA TAC CGC ТСС GCC GTC GAC АСС AAT АСТ AuG GcG AGG CGG CAG cU uuA UGGUGA mRNA UAG CGc UCc Grs Guc GAC AAU ACC ACu tRNA AA TAC CGTGGG TTT TTC ATG GTT GGG TAA AuG GuG 3. DNA GGG GCA UAC CGA CCC uUA UAG mRNA tRNA UAC CAC ССС CGU AUG A AU GCU GGG AUC AA 4. DNA ATG CGI GGG TTI TTC ATG GTAGEG UAC GCA CCC AAA AAG UAC CAA mRNA AuG CGu GGG Wlir lur AuGGuu GGGUAA tRNA AA MET ARG GLY PHE PHE МЕТ VAL GLY (STOP) 5. DNA TAC CTCACA CTAGCT ATG 7G cc mRNA UGU GAU tRNA CU C UUG AUU Itr VAL LEU MET AA TFR ALA PROLearning Task 3: TRACE THE CODE dentify the amino acids coded for by the MRNA codon using the Genetic Code Table below. Order of bases in mRNA (codon) AUC Order or bases Order of bases Amino acid Coded in DNA in tRNA into Proteins TAG CAT GC СА UAC Methionine Valine Procedures: Copy and fill in the table Refer to the Genetic Code table to identify the amino acid. To determine the order of bases in the first column (DNA), second column 1. 2. 3. (codon) and third column (anticodon), consider the complementary base pairs in DNA adenine pairs with thymine and guanine pairs with cytosine. 4 Example, AUG using the Genetic Code Table. Look for the first letter of the MRNA codon on the left side of the genetic code table (A). The second letter of the MRNA on the second letter column (U) and the third letter on the right-side column (G). AUG codes for the amino acid methionine. To identify the amino acid. Look at the bases in the MRNA codon. 5. Do the same with the other codons in the chart.…