How are poly-adenosine tails added to subgenomic mRNAs of RNA viruses? Repeated uracil bases on the template cause the polymerase to slip backwards and recopy the sequence Polymerases copy a 200 base string of uracils found in some RNA viral genomes Polymerases copy a 200 base string of uracils added to the template during circularization Viral mRNAs undergo post-translational modifications, which include splicing of introns, a 5'-cap, and a 3'-poly-A tail

How are poly-adenosine tails added to subgenomic mRNAs of RNA viruses? Repeated uracil bases on the template cause the polymerase to slip backwards and recopy the sequence Polymerases copy a 200 base string of uracils found in some RNA viral genomes Polymerases copy a 200 base string of uracils added to the template during circularization Viral mRNAs undergo post-translational modifications, which include splicing of introns, a 5'-cap, and a 3'-poly-A tail

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.
What is its functional difference with the RNA polymerases found in both eukaryotic and prokaryotic cells?
Ribosomal RNA in eukaryotic cells is synthesized by which of the following enzymes (exhibiting no sensitivity to either high concentrations or low concentrations of the fungal poison a-amanitin)? RNA polymerase I RNA polymerase II RNA polymerase III DNA polymerase II DNA polymerase I
Here is a partof the mRNA sequence of the spike glycoprotein of the SARS Covid-19 virus, starting with the start codon. A deletion was found in 6 bp (underlined). How will this change affect the polypeptide sequence? >S_protein AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACAAAGUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUA
In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction
Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cell
In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule? Group of answer choices Because a guanosine cap has to be removed Because exons have to be removed Because a poly-A tail has to be removed Because introns have to be removed Because the RNA primer has to be removed
The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?