How would the removal of the TATA box in a eukaryotic gene impact transcription? Group of answer choices The gene would not be transcribed Transcription would occur more slowly Transcription would occur in the wrong direction Transcription would be less processive The wrong strand would be used as a template for synthesi

How would the removal of the TATA box in a eukaryotic gene impact transcription? Group of answer choices The gene would not be transcribed Transcription would occur more slowly Transcription would occur in the wrong direction Transcription would be less processive The wrong strand would be used as a template for synthesi

Name: How would the removal of the TATA box in a eukaryotic gene impact tran
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: How would the removal of the TATA box in a eukaryotic gene impact transcription?Group of answer choicesThe gene would not be transcribedTranscription would occur more slowlyTranscription would occur in the wrong directionTranscription would be less p

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat
Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in termination
Select the processes that only happen inside the nucleus of a eukaryotic cell. Select all that apply. O making tRNA O transcribing rRNA O removing introns from precursor mRNA O transcriptional initiation at the promoter O adding the polyA tail O mRNA binding to the small ribosomal subunit ORNA splicing O tRNA binding to codons
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5'-GGCCCUUUUACCCGGUUUU-3' 5'-GCAUCUUACUGAUGCUUUU-3' a stem-loop hairpin structure followed by a sequence of uracil residues in the RNA a palindromic region followed by a sequence of adenine residues in the RNA a sequence of uracil-adenine RNA-DNA base pairs
Which of the following sites would you predict to be present in the gene encoding a MRNA molecule and what would be their order? LIST OF SITES #1 Promoter #2 Ribosome Binding Site #3 Translation Initiation Site #4 Translation Termination Site #5 Transcription Initiation Site #6 Transcription Termination Site O 3, 1, 2, 6, 4, 5 O 1, 3, 2, 5, 6, 4 О 1,5, 2, 3,4, 6 О 1,3, 2,4 О 1,3,4
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
You are searching the sequence of a coding strand of DNA. What kinds of sequences would help you find the beginning of a protein-coding gene? Group of answer choices a promoter sequence upstream (to the 5' end) of a transcription start site and an ATG sequence corresponding to the start codon a transcription termination sequence a silencer sequence an ATA sequence corresponding to the codon for isoleucine
Prokaryotic cells can have more than one functional start codon per mRNA because There are multiple answers A prokaryotic promotes consist of two separated sequences: the -30 box and the -10 box B they make polycistronic RNA C both transcription and translation happen in the same cellular compartment D prokaryotic ribosomes bind to the Shine-Delgarno sequence E the activity of the lac repressor is regulated based on the physiologic condition of the cell
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA