How would you use PCR-amplified oligonucleotide directed mutagenesis to create deletion of amino acids 75-83 in subtilisin or insertion of the amino acids glycine- glycine-glycine between amino acids 74 and 75 of subtilisin
Q: A restriction enzyme with a 6 base pair recognition site will cut the human genome roughly a. 70…
A: A gene is the most fundamental unit of hereditary. A gene is made up of multiple nucleotide…
Q: Describe the following techniques for determining gene or protein function with advantages…
A:
Q: You need to perform PCR to amplify a gene for this assignment. You will create a PCR solution with…
A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…
Q: The advantage of RNAi over other functional genomic techniques or as a potential pharmaceutical…
A: RNA interference or RNAi is the post-transcriptional silencing method to turn off the expression of…
Q: What can serve as footprints to identify genome sites that are or have been occupied by transposable…
A: A genome is a collection of an organism's genetic information.
Q: Suppose you have previously located and cloned a human gene on chromosome 2. You now believe there…
A: The genome of an organism is defined as the whole genetic information that is inherited from one…
Q: What is the possible cause of the presence of an extra band in the results of DNA extraction and PCR…
A: This finding suggests that formation of multiple bands in non-denaturing gel electrophoresis is a…
Q: The enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy.…
A: Enzymes Enzymes are the protein that use as catalysts in metabolic and catabolic reaction to fasten…
Q: When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What…
A: Due to their small size and minimal requirements, many Drosophila can be raised and tested within a…
Q: Consider a bacterium that can synthesize an imaginary amino acid called fictamine. Initially,…
A: ANSWER;- i) Gene Y codes for enzyme 1 because when gene Y is mutated, the activity of enzyme 1 is…
Q: Bacteriophage lambda (λ) consists primarily of a head, which contains the genomic DNA, and a tail…
A: Answer: Bacteriophage are the bacteria infecting viruses, which are able to infect bacteria. These…
Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…
A: The mutation is a permanent alteration in the nucleotide sequence of DNA molecules. The mutation…
Q: Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the…
A: Answer
Q: If you didn't know the sequence of the segment of DNA you want to amplify, how would you perform the…
A: Polymerase chain reaction is defined as the type of laboratory technique where it is used to amplify…
Q: What primers will be used to sequence your PCR product where are those sequences on your PCR product…
A: PCR is a technique used for amplification of DNA/gene of interest. At the end of the PCR technique…
Q: Which of the following is a correct statement about the primers used in the ALU insertion PCR…
A: Answer - Option B - The primers for both + and - alleles are the same and are on flanking regions…
Q: An RNA-dependent DNA polymerase that carries the RNA template with it to synthesize repeats at the…
A: Replication is the process of duplication of the DNA. Replication is initiated by recognizing the…
Q: You are working in a molecular biology laboratory and are having challenges with your PCR. You…
A: Polymerase chain reaction (PCR) is the method employed by the geneticist to multiply the number or…
Q: Which of the following types of physical mutagens produces thymine dimmer mutations? A- gamma rays…
A: Given: Physical mutagens produces thymine dimmer mutations.
Q: Site directed mutagenesis is used to: 1.determine the critical base per sequences in a Genome 2.…
A: DNA consists of double strands of sequentially arranged nucleotides. The nucleotide sequence present…
Q: You are trying to study the effects of Drug A on the expression of Gene X in a tumor sample (lane…
A: Reverse transcription enzyme chain reaction (RT-PCR) may be a variation of normal PCR that involves…
Q: You’re working in a research lab, and your current task is to clone the gene that codes for…
A: The cloning process is used to introduced a foreign DNA into the genome of a particular host…
Q: You’re working in a research lab, and your current task is to clone the gene that codes for…
A: Recombinant DNA technology is one of most significant techniques of genetic engineering. It enables…
Q: The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA…
A: The following is the DNA information received by gel electrophoresis: In lanes 1 and 2, each…
Q: The picture below depicts an aberration in the process of genetic coding. Which of the following…
A: DNA replication is the process by which a new DNA is synthesized by using a parental DNA molecule.…
Q: Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes
A: Directional cloning is the technique which is accomplished by cleaving the plasmid vector with two…
Q: Which of the following mutagens can substitute bases in DNA because of structural similarity?…
A: A mutagen is defined as any physical or chemical substance that can cause a mutation by altering an…
Q: The genomic DNA of a bacterial cell is not destroyed by the cell’s own restriction enzymes because…
A: BASIC INFORMATION RESTRICTION ENZYME they are also known as molecular scissors it was in the year…
Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: The bacterial primase enzyme synthesizes _______________________. a short DNA primer using RNA as…
A: Given: The bacterial primase enzyme synthesizes.
Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…
A: Hi, Thanks For Your Question. Answer : Correct Option Is b (20%) Explanation : P (III-7 Is…
Q: Ideal primers for the PCR reaction should have the following feature: they should have a high A-T…
A: Polymerase chain reaction (PCR) is a laboratory technique for rapidly producing (amplifying) large…
Q: The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction…
A: The restriction enzymes cuts specific sequence on double stranded DNA molecule and they are used in…
Q: What is function of DNA ligase? Why bacteria serve as an excellent tool for recombinant DNA…
A: DNA replication is a process in which DNA makes copies of itself and this property of DNA is used in…
Q: You want to set up 50 µl total volume of a PCR reaction. You have a microfuge tube of Forward primer…
A: Polymerase chain reaction (PCR) is a widely used method for rapidly producing millions to billions…
Q: Which enzyme is required for the movement in DNA-only transposons? Group of answer choices Reverse…
A: In early 1970s, a number of researchers including Peter Starlinger and James Shapiro, independently…
Q: Four different pairs of PCR primers (in blue) are shown below. Each primer is shown in the location…
A: The “PCR primer” is the short piece of ssDNA of about 20 nucleotides in length. It is being used in…
Q: The complete genetic information of a person is isolated from some of her cells, cut with…
A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…
Q: The mutagen that most often causes thymine dimers is/are ________. Group of answer choices…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: You want to determine the transcriptomic response to heat shock in [Choose ] a normal cell line.…
A: Transcriptomic is the study of total RNA present at a particular time in a particular cell. To…
Q: has been assembled by researchers and transplanted into a donor bacterial strain to study never…
A: A- recombinant plasmid B- developmental genetics
Q: Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel…
A: Next-generation sequencing (NGS) is a massively parallel sequencing technology that offers…
Q: Describe the different vectors that you would use for cloning DNA fragments of lengths 2,000;…
A: A cloning vector is a small piece of DNA that can be stably maintained in an organism, and into…
Q: What are the key modifications to the PCR primers, SHFw1 and SHRv1 in order for you to clone the PCR…
A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…
Q: A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6…
A: Restriction enzymes are also known as restriction endonucleases. These are the enzymes produced by…
Q: If a researcher attempted to do a PCR amplification of the slc24a5 gene in the gol1 mutatant line,…
A: PCR Stands for polymerase chain reaction and is used in the amplification of DNA It has three steps…
Q: Redraw Figure 10-6 with the goal of adding one EcoRIend and one XhoI end. Below is the Xhol…
A: There are specific regions in the DNA, which have specific sequences called restriction sites,…
Q: In conventional PCR applications, a heat-resistant polymerase is used. Why? You want to identify and…
A: "Since you have posted a question with multiple sub-parts, we will solve first three subparts for…
Q: Describe three possible uses of site-directed mutagenesis.
A: Site-directed mutagenesis is to understand which gene is responsible for the desired trait.
Q: PCR errors during library amplification are one possible source of false positive results. If an…
A: PCR is a polymerase chain reaction. This is a biotechnology used to amplify the DNA copies.
How would you use PCR-amplified oligonucleotide directed mutagenesis to create deletion of amino acids 75-83 in subtilisin or insertion of the amino acids glycine- glycine-glycine between amino acids 74 and 75 of subtilisin
Step by step
Solved in 2 steps
- A possible forward primer to be designed is a primer that binds to the region of the OXA-M290 gene where the start codon is located, and the reverse primer is the primer that binds to the region of the gene where the stop codon is located. In order to clone the PCR product generated using these primers into pET-28a, extra nucleotides must be added to the 5' ends of the primers. These extra nucleotides will contain the recognition sites for the restriction enzymes that are used for cloning. When the DNA produced by PCR using these primers is treated with the restriction enzymes, this will generate sticky ends at the ends of the PCR product. If pET-28a is digested with the same restriction enzymes, the sticky ends of the PCR product will bind to the sticky ends on the digested pET-28a, allowing the two DNA molecules to be connected together by DNA ligase. Which primer (forward or reverse) should contain the SacI recognition site, and which primer (forward or reverse) should contain the…For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
- Transposon mutagenesis was used to generate a library of mutants within the Salmonella genome. You are trying to identify a colony with the transposon inserted in the pathogenic related gene SPI-1 using PCR. Forward and reverse primers are generated that flank either side of the gene and yield a wild type product that is 900 bases in length. Which of the colonies sampled in the gel would you expect to contain the SPI-1 gene with transposon insertion? 3,000 2,000 1,000 700 500 300 100 Ladder Colony A Colony B Colony C Colony D Colony E none colonies A&C colonies B&E O colonies A, C, &D colonies B, D, &E -Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'In cloning a specific fragment from a mixture of different fragments of DNA, three classes of plasmids can be produced: vector containing the desired fragment (gene of interest), vector containing other fragments, and re- ligated vector containing no inserted DNA. What class of vector would you expect to find at the highest frequency? Multiple Choice All three types of vector will be found in approximately equal proportions Vector containing random genomic DNA fragments Vector containing the gene of interest Vector with no insert ww
- The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below. What does each pattern say about the cloned DNA? Note: pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.
- PCR errors during library amplification are one possible source of false positive results. If an error occurs in the first round of amplification, all the subsequent copies of that library fragment will also carry the variant, even though it is not present in the genome. However, reads from other library fragments spanning this same region will not have the variant, which means that identifying PCR copies, or clones, of library fragments during analysis can help to identify these types of errors. Based on what you know about PCR, which of the following statements would be true about the PCR clones in a sequencing library? A. PCR is subject to amplification bias, so reads derived from PCR clones will only map to regions that are not GC-rich. B. PCR is subject to amplification bias, so reads derived from PCR clones will only map to non-repetitive regions. C. PCR produces identical copies, so reads derived from PCR clones would map to the exact same location. D. PCR introduces many…An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thxDuring your experiment you analysed only a few of the recombinant clones for the presence of the highly repeated Aluelements. If you wanted to screen for a single-copy gene, you would need to screen a much larger genomic library. Assuming, that you already know the amino acid sequence of unicorn (a species with a similar physiology to humans) insulin, how would you construct a probe which would enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for the insulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors, enzymes, and DNA sequencers.