Identify if SN1, SN2 and so forth. Catabolism of triacylglycerols- beta-oxidation pathway Biosynthesis of fatty acids from Acetyl CoA Glycolysis (from glucose to two molecules of pyruvate) Conversion of Pyruvate to Acetyl CoA Citric acid cycle Gluconeogensis pathway (pyruvate to glucose)
Q: What biomolecules have alcohol functional group in them? Give an example of a specific biomolecule…
A: Biomolecules possess different functional groups such as alcohol group, amino group, carboxyl group,…
Q: Which of the following proteins can BEST serve as a marker to detect the presence of the chloroplast…
A: The presence of biological or molecular markers provides information regarding their source.…
Q: 4) For the structure shown on the figure - qualitatively draw Ramachandran plot. Assume a mixture of…
A: Ramachandran plot is a 2-dimensional plot describing the allowed rotation in a protein. A protein…
Q: For the tetrapeptide YIRG: a. Draw its complete protonic equilibria. Indicate the net charge of each…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: Calculate the pI of the peptide KLMRDSP (pKa = 3.5, 3.9, 9.5, 10.0, 12.5).
A: The amino acids contain ionizable groups. The ionic form of these groups depends upon the pH of the…
Q: The overall process of glycolysis converts a C6 molecule into: O A different C6 molecule O Three C2…
A: Glycolysis is the catabolic pathway and is the first step of cellular respiration that takes place…
Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…
A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…
Q: 1. Deduce the primary structure of this polypeptide. 2. Why would cyanogen bromide not be a good…
A: a) Given the molecular weight of the peptide is 4000Average MW of an amino acid is 110 Da. So, the…
Q: Which one of the following statements about PEP (phosphoenolpyruvate) synthesis is correct? Pyruvate…
A: PEP, also known as 2-phosphoenolpyruvate, is a crucial biochemical intermediary. It participates in…
Q: What is the experimental procedure illustrated in the figure above? What label (1-3 words) would…
A: In the given diagram, some cutting and joining of DNA is shown. In the diagram, a specific gene…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…
A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…
Q: For the amino acid arginine: Draw its complete protonic equilibria. Indicate the net charge of each…
A: Zwitterionic form is a form of molecule which has a net charge of zero.Also this form is very…
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Which one of the following features does NOT make HDL a 'good' lipoprotein. It acts as an…
A: High density lipoprotein is the smallest lipoprotein with a size of 5 to 17 nm. It functions to…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…
Q: Select all of the examples of potential energy in the human body below. There may be more than one…
A: INTRODUCTION : Potential energy - It is a type of stored energy which depends upon the relative…
Q: The AG of the reaction C6H12O6 +602 --> 6CO2 + 6H₂O is -686 kcal/mol glucose The oxidation of…
A: For biological systems, free energy (G), enthalpy (H) and entropy (S) are related as : ∆G = ∆H - T∆S…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific points. Trypsin…
Q: 8- A B ATP C D А E
A: The cell membrane is composed of a lipid bilayer that allows small and nonpolar molecules to pass…
Q: What would be the standard free energy change if FADH 2 is used to reduce O 2 to water? Standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: 5. Oxaloacetate, glycerol, and lactate can be used in gluconeogenesis. T F
A: Sometimes organisms need a method to synthesize glucose from non-carbohydrates precursors. The…
Q: Which one of the following amino acids is phosphorylated during the process of promoter clearance by…
A: In eukaryotes RNA Polymerase II is responsible for the synthesis of mRNA. The largest subunit of Pol…
Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…
A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…
Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…
A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…
Q: Determine the chemical formula for the following molecules by counting the Carbon, Hydrogen and…
A: Introduction : Carbohydrates - Also known as carbs, are sugar molecules which consists of…
Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…
A:
Q: Which is the strongest non-covalent interaction that occurs between triglycerides: hydrogen bonds,…
A: - A non-covalent bond is one in which there is no sharing of electron pairs. It mainly occurs…
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…
A: An oxidizing species is the substance that donates electrons, and a reducing species is the…
Q: When one molecule of glucose is processed through the glycolysis pathway, there will be: Net gain of…
A: All living cells use the catalytic process of glycolysis. The Embden-Meyerhof-Parnas (EMP) pathway…
Q: If there is ample oxygen available, how many ATP can be produced from complete oxidation of glucose…
A: The aerobic breakdown of nutrients into carbon dioxide, water, and energy occurs during aerobic…
Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Glycolisis is process that is reversible, meaning that any product that is being formed can easily…
A: During the catabolism of amino acids, for it to be used as a respiratory substrate, first the alpha…
Q: 1. Explain the stepwise breakdown of starch. 2. Discuss the role of undigestible carbohydrates in…
A: Starch is a polysaccharide, made up of two units; namely amylose (α 1-4 linkage) and amylopectin (α…
Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…
A: INTRODUCTION : Sulfide minerals - They are a class of minerals consisting of sulfide or disulfide…
Q: 2. You made a pH=2.5 buffer solution by mixing NaOH and glycine to give a solution that is 0.20 M in…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: What is the goal of glycolysis? What do we start with and what do we end with? How much net ATP is…
A:
Q: What charged groups are present in lysine at a pH = 7?
A: Amino acids are building blocks of proteins. The alpha carbon of amino acids consist of amine group,…
Q: What effect is seen on a Lineweaver-Burke graph when a non-competitive inhibitor is added to an…
A: The enzymes can be regulated in presence of competitive, uncompetitive and noncompetitive…
Q: Mach column (A) with Column (B)?* Waxes Serous gland Sphingolipids Fatty acid Beta oxidation Ketone…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: 2. What is the total yield from one molecule of glucose to two molecules of L-malate? A. 2 ATP/GTP,…
A: Glucose is converted to L-malate via the following pathway: 1. Glycolysis: 1 glucose is converted to…
Q: 1. State if true or false a. GLUT5 transporter carries fructose from the intestinal lumen into the…
A: GLUT5 Transporter : GLUT5 is a fructose transporter found & expressed on the apical border of…
Q: Lipogenesis, or fatty acid synthesis, occurs in several cycles. A diagram of the reactions of the…
A: De novo synthesis of fatty acids takes place in the cytosol of all eukaryotes. Fatty acids are…
Q: Concerning the citric acid cycle (TCA cycle), which of the following statements is false? The TCA…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…
A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…
Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…
A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…
Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…
A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…
Q: Among the given statements, which ones correctly describe the commonality in dopamine and…
A: The adrenal gland secretes three catecholamines-dopamine, epinephrine and norepinephrine. Dopamine…
Identify if SN1, SN2 and so forth.
- Catabolism of triacylglycerols- beta-oxidation pathway
- Biosynthesis of fatty acids from Acetyl CoA
- Glycolysis (from glucose to two molecules of pyruvate)
- Conversion of Pyruvate to Acetyl CoA
- Citric acid cycle
- Gluconeogensis pathway (pyruvate to glucose)
Step by step
Solved in 4 steps with 12 images
- Discuss how the isozymic forms of acetyl CoA carboxylase regulate fatty acid metabolism. Explain the reciprocal regulation of fatty acid production and breakdown, as well as the numerous mechanisms that are used to accomplish this control.Indicate what will happen (increase, decrease or no effect) to the activity of enzyme or rate of the metabolic pathway given the following conditions: 1. release of glucagon in the blood to the activity of carnitine acyl transferase 1 2. phosphorylation of acetyl CoA carboxylase 3. low [carbon dioxide]/[oxygen gas] ratio to the oxygenase activity of RuBisCODiscuss the regulation of fatty acid metabolism by the isozymic forms of acetyl CoA carboxylase. Explain the reciprocal control of fatty acid synthesis and degradation and the various means by which this control is achieved
- Once formed, what are the three possible fates of pyruvate and under what conditions do they occur? Match the appropriate pairs. Clear All pyruvate forms lactate pyruvate forms ethanol pyruvate forms acetyl-CoA under anaerobic conditions in animals under aerobic conditions under anaerobic conditions in yeast and other microorganismsGlucagon secretion inhibits intracellular acetyl-CoA carboxylase activity through a number of different methods. Make a list of everything that comes to mind.Which of the following reactions required dihydrolipoyl dehydrogenase? Oxidative decarboxylation of pyruvate Oxidative decarboxylation of a-ketoglutarate Both A and B Neither A nor B Fatty acid biosynthesis is stimulated by: Decreased levels of citrate Increased levels of palmitoyl-CoA Increased levels epinephrine Increased levels of AMP All of the above None of the above
- Number the oxygens(1-6) in any order. Trace the path of this glucose through pathways of glycolysis and the TCA cycle and determine which step of the pathways each oxygen is removed from the process.Match the statement to the corresponding metabolic pathway. Choices. (Lipogenesis or Lipolysis) Fatty Acid Synthase Fatty Acid to Acetyl CoA Primary sites involve liver, adipose tissue and mammary glands Beta-Oxidation Inner matrix of the Mitochondria Pyruvate from Glucose Occurs in Cell Cytosol Enters TCA Cycle Acetyl-CoA Carboxylase Triglyceride to Glycerol. Glucagon secretion causes inhibition of intracellular acetyl-CoA car- boxylase activity by several mechanisms. Name all you can think of.
- In 3-4 sentences, briefly explain how lactate is formed, the biological effect of lactate, and explain the biochemical process and path for conversion of lactate. 3. The hormones glucagon, epinephrine, and insulin, can regulate blood glucose levels to protect the brain. For each one provide a short explanation as to whether it raises or lowers glucose how it does this, and indicate whether it is metabolic or catabolic.Please explain the role of pantothenic acid-derived CoA as a carrier of acetyl group in carbohydrate metabolism.Although glucose cannot be formed from acetyl-CoA, triglycerides can enter the glycolytic pathway via which process? O Acetyl-CoA → oxaloacetate → phosphoenolpyruvate O Palmitoyl-CoAB- ketoacyl-CoA → a-ketoglutarate O Glycerol → DHAP Acyl-CoA glucose