Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a strand is shown magnified and rotated. Identify whether it is the 5' end or the 3' end, and identify the base. Answer Bank 5' cytosine 3' guanine 3' thymine major groove 5' adenine minor groove
Q: Which of the following statements regarding Michaelis-Menten kinetics is TRUE? The ES complex can…
A: According to Michaelis Menten the MM) equation, the rate and velocity of enzyme catalyzed reaction…
Q: 1. Explain what happens in the following stages A. S phase: B. Prophase: C. Anaphase: D.…
A: The question is asking for a detailed explanation of what happens during the S phase, Prophase,…
Q: 3. The IC50 value for a drug called razundib for a Src kinase is 15 nM. The Src kinase is known to…
A: Src kinase is a tyrosine kinase that catalyses the phosphate group transfer from ATP to the tyrosine…
Q: How many dissociable protons are present in Tris buffer? How did you come to this conclusion?…
A: Tris buffer is also known as tris(hydroxymethyl)aminomethane. It is an organic compound with the…
Q: Which Ami no acids can be found in the following peptide?
A: Amino acids are biomolecules that have a hydrogen atom, an amino group, a carboxyl group and a side…
Q: In what way are carbon-based compounds like children's Tinker Toys or Lego blocks? Give a few…
A: Carbon-based compounds are often compared to children's Tinker Toys or Lego blocks because carbon…
Q: Choose all of the completely correct statements describing peptide X below: 00. 00 HO. O €0 NH3 O:…
A: Proteases are the protein digesting enzymes which cleave peptide bonds. There are some proteases…
Q: D raw the full structure of the following tetrapeptide . Label the N terminal and C terminal…
A: An amino acid is a biomolecule that has a hydrogen atom, an amino group, a carboxyl group and a…
Q: The 4 kinase steps in glycolysis are catalyzed by hexokinase, phosphofructokinase, phosphoglycerate…
A: Glycolysis is a metabolic pathway, in which "Glucose" (six carbon sugar molecule) is broken down…
Q: G Which of the following amino acids is most unlikely to be present in a beta sheet? Lysine Valine…
A: Proteins show two types of secondary structural elements. They are1) Alpha helix and2) Beta sheets .…
Q: addition to L-lactate, which of the following molecules is (are) generated by fermentation of…
A: Fermentation is an anaerobic process that occurs in the absence of oxygen, leading to the conversion…
Q: Which factor contributes to the selectivity pore of the potassium channel from S. lividans? O…
A: S lividans stands for Streptomyces lividans. It is a gram positive & filamentous bacterium that…
Q: SARS-CoV-2 Spike protein variant Wuhan Alpha Beta Delta Omicron KD, nM 60 9.6 2.4 1.2 2.4 Using the…
A: Consider a protein 'P' that can bind with 5 different ligands; L1, L2, L3 , L4 and L5.The…
Q: D. Explain why a protein (polypeptide chain) will assume a different 3-dimensional structure in: (1)…
A: The three-dimensional structure of a protein, also known as its native conformation, is critical for…
Q: Problem 3
A: The objective of the question is to determine the genetic distance between two genes, F and G, in…
Q: Genetics Question 5
A: The objective of the question is to identify the correct event that occurs during the Anaphase of…
Q: Use the figure below to answer which lipid is the most soluble and why? ...
A: Lipids are organic compounds which are polymers of fatty acids that contain a long, non-polar…
Q: What is the energy charge for the cell with concentrations of [ATP] = 1.000 mM, [ADP] = 10.00 uM,…
A: The energy charge, EC of a cell can be calculated using the formulaEC = [ATP + (1/2 ADP) ] / (ATP…
Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…
A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…
Q: Construct the two enantiomeric forms/structure of the following monosaccharides and designate the…
A: Monosaccharides are simple sugars, the basic units of carbohydrates. There are two types of…
Q: "LD50" refers to the median "lethal dose," which is the concentration at which 50% of the population…
A: Drugs are chemical substances that impact our body's function, including the mind. They come in two…
Q: 2. Match the following molecules with the-corresponding test reagents that are used to identify…
A: Biochemical tests are very important in the field of biology and biochemistry. These tests are used…
Q: If non-disjunction occurs at meiosis 2 in a male, 2 of the 4 sperm formed in that meiosis will have…
A: Non-disjunction can happen in meiosis 1 or meiosis 2.Non-disjunction is said to have taken place in…
Q: 3. The image below depicts 2,3-bisphosphoglycerate depicted in dark gray, and ß subunits are…
A: The objective of the question is to understand the role of 2,3-bisphosphoglycerate (BPG) in the…
Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…
A: (i.) ΔGunfolding = 2100.30 J/mol or approximately 2.10 kJ/mol (ii.) ΔGunfolding = -5446.52 J/mol…
Q: a) Based on the data shown in the image, what are the Km and Vmax for the enzyme with L-DOPA and…
A: Enzymes catalyse biochemical reactions by lowering their activation energy. Enzymes bind to their…
Q: 11. Quantitative Relationships between Rate Constants to Calculate K, Kinetic Efficiency (kcat/Km)…
A: Kinetic parameters are Km and Vmax. They are used to determine the efficiency of an enzyme. Km is…
Q: Draw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.
A: The reaction is an example of reduction reaction where both the functional group reduces into the…
Q: Polymer beads (resin) made of DEAE (diethylaminoethyl) cellulose are packed in an ion exchange…
A: DEAE cellulose resin had some groups which are positively charged and can bind proteins through…
Q: Week 8 Q1
A: The objective of this question is to understand the concept of translocation in genetics and to…
Q: For each of the following mRNA sequences predict the appropriate protein sequence: a.…
A: Genetic code refers to the instructions contained in a gene that instructs a cell how to make a…
Q: How can gene duplication aid in phenotypic divergence? Briefly describe how the lac repressor and…
A: Lac operon codes for three genes; Z, Y and A which are essential for lactose metabolism i.e. these…
Q: 4nM 10 μΜ Ο 0.01 nM Ο Ο Ο 2 nM -2 nM
A: A Hill Plot is a type of graphical representation used in pharmacology and biochemistry to show how…
Q: How do glucagon and epinephrine affect glycogen in the liver? They increase both glycogen breakdown…
A: Glucagon is a polypeptide hormone secreted by the alpha cells of Iselets of pancreas. Glucagon is…
Q: To better understand how the lacR works, let's start let's approximate the volume of a bacterial…
A: The bacterial cell is considered as a cylInder. The equation to find volume of cylinder is ''.
Q: In the alpha helix shown below, all carbonyl groups are pointing_ amino groups are pointing…
A: The secondary structure of a protein refers to the folded configuration of the polypeptide chain.…
Q: The Drug AZT is used to treat AIDS, This drug is a _____ Inhibitor/Activator of _____ a)…
A: HIV stands for human immunodeficiency virus. HIV destroys a type of white blood cells that help the…
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: According to Watson-Crick base pairing rule, adenine (A) pairs with thymine (T) while guanine (G)…
Q: Which of the following is true of the difference between Class I and Class II B-lactamase…
A: Beta lactamase inhibitors are the substances or compounds that inhibit beta lactamase enzymes. Beta…
Q: Sketch out the binding site of Hemoglobin with oxygen bound . ( You can abstract the Heme ring out…
A: Hemoglobin is a metalloprotein that contains iron. Hemoglobin is present in the red blood corpuscles…
Q: s) In two experiments carried out in a research lab, an enzyme reaction is run with and without an…
A: Enzymes are proteins that catalyze biochemical reactions. They contain an active site where the…
Q: I need help with drawing Hydrogen bonding between two tripeptide: Ser-Lys - Ser. In my class, we are…
A: The peptide backbone has a zig-zag structure with the hydrogen and side chain bonded to alpha-carbon…
Q: Consider a crude extract with a mixture of the 5 proteins listed below. Protein A 4.5 pl 160…
A: Ion Exchange ChromatographyIon exchange chromatography can be used to separate proteins that have a…
Q: I JUST WANTED TO NOTE THAT OPTION C IS 100% WRONG AND YOU CAN ONLY CHOOSE ONE OF THE OTHER 4 OPTIONS…
A: The DNA double helix's structural characteristics and interaction sites are described by the…
Q: Cellulose contains___ linkages that ___ be digested by animals. a β1--> 4 glycosidic ; canNOT b…
A: Cellulose is a polymer of units. It is used by plants and some microbes as a means of mechanical…
Q: You are working on a protein with the following sequence in an area of interest.…
A: Proteins are made up of different amino acids. Some amino acids have ionizable side chains. All…
Q: In the following scheme: HNH, IT H,C-C-C-Coo II H HO 1 O NH, 1 H₂C-C-C-COOⓇ H 2-Amino-3-ketobutyrate…
A: Metabolism consists of catabolism and anabolism. Catabolism refers to the breakdown of compound to…
Q: Refer to figure 1D of the Science Article. Which produces the greatest inhibition of PDE…
A: In the experiment described, the researchers tested the inhibitory effects of different…
Q: Genetics Question 10
A: The question is asking about the sequence of events that occur during meiosis and the preceding…
Q: Describe the mechanism behind the hydrophobic effect. Support your description with one drawing.
A: The hydrophobic effect is the tendency of nonpolar molecules to aggregate in aqueous solutions. This…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 3 images
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.asapGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
- Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DNA (black spheres are oxygen atoms; red lines are hydrogen bonds). G1 B1 G2 G4 Identify the base marked as B1. Identify the base marked as B2. B2 adenine thymine G3 Identify the general location (G1-G4) of the minor groove. G4 Identify the general location (G1-G4) of the major groove. G2 >This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.
- Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxxWhat is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA? syn anti alpha heteroDesign a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
- If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAGExamine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG