If a diploid organism has 14 chromosomes (2n=14) a. How many chromosomes will its gametes have? b. After meiosis I during gamete formation, how many chromosomes are in each daughter cell? c. After meiosis I during gamete formation, how many chromatids are in each daughter cell?
Q: Monocot flowers possess parts in whorls or multiples of -__________, while dicot flowers possess…
A: Monocot flowers are the flowers having one cotyledon. Dicot flowers are the flowers having two…
Q: Please answer all question below. These are all the questions left. Question 7: Select one answer.…
A: Aldosterone is a hormone that is released by the adrenal gland in response to low blood pressure and…
Q: E. coli strains diploid for the lac region were constructed by introducing a plasmid carrying the…
A: ANSWER;- I- mutation- repressor is unable to bind to the operator region. If there is no other…
Q: Which of the following lipoproteins is primarily involved in the transport of cholesterol from the…
A: Lipoproteins are complicated molecules that have a central core holding cholesterol esters and…
Q: 6) Describe the three major factors that may affect blood pressure.
A: Blood pressure is the pressure of circulating blood against the walls of blood vessels.
Q: In which of the following phases does this specific arrangement of chromosomes occur? No answer O…
A: 25) The given arrangements of the chromosome shows the stage in which the genetic material of the…
Q: Match the letters in the empty boxes to the correct words or structures. A B C D E F G Citric acid…
A: Cellular respiration is a metabolic process in which glucose molecule is used up in the synthesis of…
Q: A heterozygous individual is crossed with a homozygous recessive individual. a. Draw a Punnett…
A: Punnett square of cross between heterozygous individual and homozygous recessive individual.
Q: How many Barr bodies are contained within the nucleus of a person with Monosomy X? In the nucleus of…
A: Introduction:- The X chromosome is shared by both males and females. Female somatic cells do not…
Q: a) Define the Following: i) Ecology ii) Environment iii) Ecosystem b) State and Explain the…
A: a) Define the Following: i) Ecology ii) Environment iii) Ecosystem b) State and Explain the…
Q: select a microbe that has proven to be either environmentally or socially beneficial to human…
A: In this question we have to describe about the useful bacteria . See full answer in step 2.
Q: Which of the following is not true for a critically endangered species? Expression of deleterious…
A: Answer--- correct option is D
Q: Globular cells are said to be spherical. When slightly flattened, they are disc-shaped. Squamous…
A: Ques : What is the shape of the cartilage cell(1), bone cell(2), and cardiac muscle(3) specimens?…
Q: Of the following species concept, which one emphasizes reproductive isolation as the major cause for…
A: Species Concept Differences present between individuals help in differentiating the species. A…
Q: You reach for your smartphone and then put it down. You reach for it again but different neurons…
A: Introduction Neurology:- It is a branch of medicine dealing with disorders of the nervous system.
Q: Q14. An insertion has occurred within the sixth codon of an mRNA sequence during transcription. What…
A: Basically a triplet grouping is used in genetic coding and there is always a reading mechanism in…
Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…
A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…
Q: Construct a diagram to explain FSH & LH and how their roles affect the female reproductive system
A: FSH ( Follicle stimulating hormone ), LH ( Luteinising Hormone), FSH and LH are the lipid hormones…
Q: 5. Which nervous system holds the brain and spinal cord? Central Nervous System b. Peripheral…
A: Introduction Brain:- The organ inside the head that controls all body functions of a human being and…
Q: Which refers to the thickening and hardening of the arteries caused by plaque build-up?…
A: The hardening of the arteries occurs when fat, cholesterol, and other substances build up in the…
Q: by Rhizobium species?
A: Answer is P,R and S. Nodulation factors (Nod factors) are chitooligosaccharides produced by…
Q: Question 24 Match the lipoprotein or reaction based on the lipid transport pathway shown: DIETARY…
A: The blanks are filled as follows and the option is assigned to the right place.
Q: Which of the following is true about integral proteins according to the fluid mosaic model? Integral…
A: Proteins are large and complex macromolecules formed by the combination of different amino acids.…
Q: Which is NOT true about sand dollars? A. originally posses spines but lost it as the organism…
A: Sand dollars belong to the echinodermates. They have radially symmetry. The body is divided into…
Q: Using the Punnett's Squares below, name the offspring of all possible parent combinations. T T T t T…
A: TT TT TT TT So here all offsprings will be tall (homogeneous dominant).
Q: When antibiotics and vaccination techniques were first discovered, the statement was made that all…
A: Vaccine can be defined as a non virulent preparation from the antigenic material ,which is able to…
Q: How is the topic about climate change, the effects of human activities and the species verge of…
A: Humans and wild animals face new challenges for survival because of climate change. More frequent…
Q: Shown below are single-stranded DNA probe and target sequences. Where on the target sequence will…
A: In cells, DNA (Deoxyribonucleic acid) is the nucleic acid that functions as the original blueprint…
Q: Which enzyme catalyzes the conversion of Cholesteryl ester to cholesterol and fatty acid? O…
A: Cholesteryl ester, a dietary lipid, is an ester of cholesterol. The ester bond is formed between the…
Q: Match the description on the left with the correct term on the right. Some answers may not be used.…
A: Match the correct term on the right to the correct description on the left.
Q: 2. a) Briefly describe the divisions of the Marine Environment.
A: An ecosystem is a natural community of living beings that deals with the external environment and…
Q: b. Right side 4. Wastes like excess water and salt are excreted through the pores of which organ a.…
A: Kidney is a part of excretory system. It is bean shaped on either side of spine. Disclaimer -…
Q: See question 3. Is the shaded recessive or dominant and tell me exactly were to circle please.
A: The pedigree analysis helps us to identify the mode of inheritance of a particular disease and also…
Q: Once again, justify each answer in one sentence. i) Is gene W most likely a positive or a negative…
A: A bacterium can produce fictamine, an imaginary amino acid. Initially, mutagenesis revealed three…
Q: Match lipid structures in column A with its lipid type in column B. esters of fatty acids with long…
A: Please follow step 2 for detailed explanation.
Q: efer to the table below: Saponification Number 179 260 193 185 lodine Number 102 10 111 79 Oil…
A: Introduction Iodine number defined as the number of grams of iodine that are consumed by 100 gram…
Q: A perfect flower is one in which both ________ and ______________ are present.
A: Flower The flower is defined as the reproductive part of the plant which contains male and female…
Q: Which of the following is NOT an example of active transport in animals? * Amino acids moving along…
A: Passive transport does not require energy. Active transport requires energy.
Q: Give the pros and cons regarding the mandatory labeling of food products containing genetically…
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: This first question asks you to group the different answers into the correct category. Our two…
A: Anabolism uses energy to generate chemicals that the body need for proper operation. Catabolism, on…
Q: Which of the following is not an example of a protein with a quaternary structure? Haemoglobin in…
A:
Q: Which has a posterior flagellum that spits fluids that "burns" from its anal glands? A. Amblypygi B.…
A: Scorpions are the organisms that comes under the phylum arthropods in class arachnids. This are…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: The heart is a muscular organ the size of a fist that sits directly behind and somewhat to the left…
Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…
A: The genetic material in most higher organisms is DNA or Deoxyribonucleic Acid. It is a double…
Q: What role do hydrogen ion play in the generation of ATP in cellular respiration
A: Cellular respiration is a group metabolic process used by every living organism to produce energy in…
Q: highlight the statement at the bottom
A: The circulatory system is formed by the heart, the lungs and the blood vessels. The lungs oxygenate…
Q: Using proteins as fuel requires removing which functional group before the remainder of the monomer…
A: Protein deficiency, also known as "hypoproteinemia", is characterized by low amounts of protein in…
Q: This picture shows where the bonds are broken during fat digestion, when it breaks a lipid into…
A: Fats or lipids are the organic compounds which are nearly insoluble in water.They play very…
Q: What part of the organism is used in order for it to maintain its position in its natural…
A: Introduction Crustacea:- They are any of a large group of mostly water animals with a body made of…
If a diploid organism has 14 chromosomes (2n=14)
a. How many chromosomes will its gametes have?
b. After meiosis I during gamete formation, how many chromosomes are in each daughter cell?
c. After meiosis I during gamete formation, how many chromatids are in each daughter cell?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- a. What type of cell division mitosis, meiosis I or meiosis II is shown in this figure? b. What is the diploid number of this organism? c. Provide labels for (i) and (ii)a. What phase of Meiosis II is the cell in? How do you know? b. Assuming all of the chromosomes present during Meiosis II are shown in the figure above, how many chromosomes (counting homologous pairs as two chromosomes) does a gamete from this organism have? c. Draw the same cell during the same phase of Meiosis I. Label the elements.In a zygote that begins with a complement of two homologous chromosomes pairs, A and a, and B and b: a.What chromosome compliments would you find in each somatic cells during growth? b.What combinations chromosomes would you expect to find in the gametes if the individual becomes an adult?
- In a zygote that begins with a complement of two homologous chromosomes pairs, A and a, and B and b: a. What chromosome compliments would you find in each somatic cells during growth? b. What combinations chromosomes would you expect to find in the gametes if the individual becomes an adult?Consider a diploid cell that has 2 n = 4 chromosomes: one pair of metacentric chromosomes and one pair of acrocentric chromosomes. Suppose that this cell undergoes nondisjunction, giving rise to an autotriploid cell (3 n). The triploid cell then undergoes meiosis. Draw the different types of gametes that could result from meiosis in the triploid cell, showing the chromosomes present in each type. To distinguish between the different metacentric and acrocentric chromosomes, use a different color to draw each metacentric chromosome; similarly, use a different color to draw each acrocentric chromosome.Consider a diploid cell that has 2n = 4 chromosomes: one pair of metacentric chromosomes and one pair of acrocentric chromosomes. Suppose that this cell undergoes nondisjunction, giving rise to an autotriploid cell (3n). The triploid cell then undergoes meiosis. Draw the different types of gametes that could result from meiosis in the triploid cell, showing the chromosomes present in each type. To distinguish between the different metacentric and acrocentric chromosomes, use a different color to draw each metacentric chromosome; similarly, use a different color to draw each acrocentric chromosome.
- Consider a diploid cell that has 2 n = 4 chromosomes: one pair of metacentric chromosomes and one pair of acrocentric chromosomes. Suppose that this cell undergoes nondisjunction, giving rise to an autotriploid cell (3 n). The triploid cell then undergoes meiosis. Draw the different types of gametes that could result from meiosis in the triploid cell, showing the chromosomes present in each type. To distinguish between the different metacentric and acrocentricchromosomes, use a different color to draw each metacentric chromosome; similarly, use a different color to draw each acrocentric chromosome.In a description of meiosis the terms ‘chromosome’ and ‘chromatid’ may be used. Distinguish between these two terms. There are 56 chromosomes in a mature elephant cell. If one of the elephants cells responsible for gamete production undergoes meiosis, how many chromosomes would be present in each cell after meiosis I, and then after meiosis II. Explain your reasoning.An organism has a diploid number of 20 in a primary oocyte. a. How many tetrads are present in the meiotic prophase l? b. How many dyads are present in the meiotic prophase II ? c. How many monads migrate to each pole during meiotic anaphase II ?
- imagine a giraffe whose diploid is 30. A)Under what circumstances would the giraffe go through a process of meiosis? . b) what will be the final result of this meiosis for the giraffe (# of cells + # of chromosomes/cells)If a cell with 24 chromosome pairs underwent meiosis, how many total chromatids would be in each gamete? What are three (3) differences between mitosis and meiosis?A diploid organism produces four gametes from one parent cell through the process of meiosis. Two gametes are found to have 7 chromosomes and two gametes are found to have 5 chromosomes. A) Is this the expected number of chromosomes that would be found in each gamete following a normal cycle of meiosis? If yes, explain why. If no, explain why not and describe how the gamete situation described above occurred. B) Determine the number of homologous chromosome pairs that the original parent cell contained, before meiosis began. Explain how you determined this value.