In 1975, the population of Peary caribou among the Arctic islands was around 28 000. In 1976, there were 1600 deaths and 900 births, and no immigration or emigration. Calculate the population change as a percentage. Show you
Q: Calculate Simpson's Diversity Index D. Show your solutions. species Number (n) Gammarus pulex (water…
A: We are given number of individulas of different species. We have to calculate simpson's diversity…
Q: Your hospital Vice-President for Population Health asks you to research and evaluate the most…
A: The Community Health Needs Assessment (CHNA) is an important tool for not-for-profit hospitals to…
Q: 1. What are the expected genotypes and their ratios for the gametes the parents in the crosses below…
A: The phenotype is defined as an individual's physical appearance for any particular trait. It is…
Q: Measuring gene expression of a reporter gene (e.g. gfp) under the control of an unknown promoter…
A: INTRODUCTION Gene expression is the process by which the genetic information encoded in DNA is…
Q: 8. Analyze the following graph showing an action potential occurring in a neuron. Provide the terms…
A: An action potential is a recognisable pattern of fast voltage or membrane potential rise and fall…
Q: How is collenchyma and sclerenchyma tissue similar
A: Collenchyma, parenchyma, and sclerenchyma are permanent tissues forming the ground tissue in the…
Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…
A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…
Q: 152+(8.635x102 )+(0.021x103 )
A: While adding these, we have to first change all the three numbers in same form. For this, we will…
Q: Which statement is FALSE? O a. Lignin comprises the highest percentage of dry mass of cell wall O b.…
A: A cell wall is an external structural layer that surrounds some types of cells. It may be hard,…
Q: Having five fingers on each hand is a recessive trait, yet most people in the world are born with…
A: Dominant and recessive traits are terms used in genetics to describe how a trait expresses itself…
Q: The nuclear export cycle is shown in the diagram. nuclear export receptor [Select] cargo. [Select]…
A: According to Bartleby guidelines only the 1st question can be answered. Please repost the remaining…
Q: Create a Study Tool of Eukaryotic cell organelle. Be sure to include both structure (draw or…
A: A nucleus, mitochondria, and an endoplasmic reticulum are membrane-bound organelles found in…
Q: Assuming (i) that the two chromosomes in every homologous pair carry different alleles of some…
A: Introduction :- A chromosome is a structure in cells that contains genetic material in the form of…
Q: A DNA molecule contains 28% thymine. What is the % of each purine and of each pyrimidine?
A: DNA is a nucleic acid ,which is a genetic material in the nucleus of the cell.Purines and…
Q: What are opsin genes and on which chromosome are they located in humans?
A: Introduction: A gene is a segment of DNA that provides the instructions to make a specific protein.…
Q: Explain exactly what the X25 probe is and how it allows for visualization of mRNA from the patients.…
A: Frataxin is a mitochondrial protein responsible for iron binding. When the expression of this…
Q: 13. The following chemicals are involved in electron transport. Which of these chemicals has the…
A: 13. The final carrier molecule and the electron grabber is oxygen, which unites them with hydrogen…
Q: Briefly describe the short term regulation of blood pressure and relate the failure of these…
A: Short-term regulation of blood pressure is controlled by the autonomic nervous system. Blood…
Q: - Draw three things (take your drawing cues from slides 11/12): (i) a gene with two exons that…
A: The genetic information of the cell is stored in the DNA. DNA with the help of multiple enzymes…
Q: You perform a ten-fold serial dilution of a bacterial culture to determine the number of colony…
A: INTRODUCTION Serial dilution is a laboratory technique used to create dilutions with a precise and…
Q: Sodium concentration in extracellular fluid is: O > potassium < potassium = potassium undetectable
A: When compared to only 5 g of iron and 0.06 g of copper, a typical human weighing 70 kg has…
Q: The microtubule subunits at the plus end of a rapidly growing microtubule most likely contain ATP O…
A: Microtubules are described as structures that are microscopic and consist of beta and alpha-tubulin.…
Q: CFU/mL
A: Bacteria grow on solid media as colonies. When the bacterial cell is alone, we cannot see it with…
Q: ) List the different levels of the taxonomic classification system, in the order of most inclusive…
A: Introduction: The taxonomic classification system is a hierarchical system used to categorize and…
Q: The graph below shows the population of three different families of marine organisms along five…
A: (A) Population growth at the point O is Cambrian.
Q: Our bodies start sweating when we get too hot. What type of heat exchange does sweating promote?…
A: Sweating is a natural mechanism that helps control body temperature. When the body becomes…
Q: Matter is constantly cycled between living and non living parts of the environment. Processes like…
A: Our body is made up of 49 percent of carbon as dry weight. Around 71 percent of carbon dioxide is…
Q: How do the following substances move across the plasma membranes of animal cells? a. CO₂ b. H₂O c.…
A: Terms involved in this process; Diffusion: it is a process in which movements of molecules from an…
Q: 18. Substrate-level phosphorylation is of physiological importance: in all cells to a small extent…
A: Substrate-level phosphorylation is a form of metabolic pathway that plays an important role in…
Q: What are 4 features (structural, functional, etc) that Watson and Crick discovered concerning B-DNA?
A: The discovery of the structure of B-DNA by James Watson and Francis Crick in 1953 was a major…
Q: Which structure with a diameter of 20 nm is found attached to membranes in a cell? a) Golgi body b)…
A: The plasma membrane, also known as the cell membrane, is the membrane found in all cells that…
Q: A neighboring group claims to have achieved a 120% recovery after weighing their compound…
A: Introduction Vacuum filtration is a process in which the air beneath the filter paper is evacuated…
Q: ucation if a learner is a patient, what are the ramifications of not engaging with the
A: Introduction: Class sizes are growing and technology is transforming education at all levels,…
Q: beavers build dom in a stream
A: Beavers These are large, semiaquatic rodents found in the Northern Hemisphere. These are the second…
Q: 1. Can you think of anything that would prevent meiosis from occurring in an organism with one set…
A: Introduction Chromosomes are long, coiled structures that are composed of DNA and proteins and are…
Q: What can you personally contribute to safeguard the environment and care for non-human animals?
A: We can contribute to safeguarding the environment by reducing my energy consumption, recycling and…
Q: Which of the situations below will enhance microtubule growth? O addition of a drug that inhibits…
A: The third key part of the cytoskeleton, microtubules, are hard, hollow rods with a diameter of…
Q: Give the instructions for preparing a two-fold serial dilution of serum from 0.5 mL serum and using…
A: We are given 0.5 ml saline and 0.5 ml serum. We have to prepare two-fold serial dilution of serum in…
Q: Vol. concentrate (ml) 2 3 2 3 1. What are the different dilution factors based on the volume…
A: A micropipette is a laboratory tool used for transferring precise volumes of liquid. It operates on…
Q: Long Bones: Pick your favorite long bone What is it? Draw it. Draw its markings. Label the bone's…
A: Given that we have to pick a long bone. We have to draw it with its markings and label them.
Q: Twitchin More than one answer may be correct. Question 13 options: is structurally related to…
A: Introduction: Muscle structure and function refers to the anatomy and physiology of muscle tissue,…
Q: Calculate the amount of GFP in grams produced in the 25-L fermentation used to generate cells for…
A: The green fluorescent protein is an autofluorescent recombinant protein extracted from the jellyfish…
Q: What biomolecule composes RNA pol II and TFs?
A: Introduction: The process of gene expression uses genetic information stored in the DNA sequence to…
Q: You observe a cell through a microscope and see that it has chloroplasts. To which Domain of…
A: Introduction Chloroplasts are cellular organelles found in the cells of plants, algae and some…
Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…
A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…
Q: Lactose intolerance is caused by reduced production of the enzyme lactase. A variety of digestive…
A: Lactose intolerance is a condition in which the body is unable to digest lactose, a type of sugar…
Q: how did you get 104 as the dilution factor? I got 10-2 as the dilution factor for the CNFL plate
A: The CFU stands for the colony forming units. The formula for calculating the CFU/ml is as follows:…
Q: Explain what would occur during fetal development to an XY individual with a mutation causing a…
A: Introduction: Disorders of sex development (DSD) refer to a group of conditions that affect the…
Q: The function of FG-nucleoporins within the nuclear pore complex is to: shield large, hydrophilic,…
A: Nuclear transport is the term used to describe the movement of molecules across the nuclear…
Q: Match the structure to the description 1. 2. 3. 4. 5. 6. Cerebellum 7. Pineal Gland 8. Thalamus 9.…
A: Sheep brain dissection is a laboratory experiment in which the brain of a sheep is dissected and…
In 1975, the population of Peary caribou among the Arctic islands was around 28 000. In 1976, there were 1600 deaths and 900 births, and no immigration or emigration. Calculate the population change as a percentage. Show your work.
Step by step
Solved in 2 steps
- The moose population in Northern Alberta is estimated to be around 11, 800. During the year, there were 5330 births, 4809 deaths, 12 immigrations and 45 emigrations. Calculate the per capita growth rate. Express your answer as a value between 0 and 1 rounded to two decimal places. If the population is decreasing indicate this with a negative sign.The moose population in Northern Alberta is estimated to be around 11, 800. During the year, there were 4557 births, 3587 deaths, 84 immigrations and 48 emigrations. Calculate the per capita growth rate. Express your answer as a value between 0 and 1 rounded to two decimal places. If the population is decreasing indicate this with a negative sign. AnswerIn 2017, 16 bison were released into Elk Island National Park. Within the next five years, 42 more bison will be released into the 1,200 km2 area. During the study period, it is expected that 45 calves will be born and 13 bison will die or be removed from the study area. What is the expected per capita growth rate of the bison population during this study period? Express your answer rounded to two decimal places. If the population is decreasing indicate this with a negative sign.
- Once an abundant species in Alberta, the caribou population is currently staggering at approximately 6,700 individuals. Little Smoky caribou herd is located in Northern Alberta, and its population is a risk of extirpation. In 1970, there were only 123 caribous in the Little Smoky area with a per capita growth rate of –0.258 between 1970 and 2012. What was the population of Little Smoky caribou herd in 2012? Express your answer rounded to the nearest whole number.S2) Below are two tables showing the population size and deaths by age for one year in the states of Louisiana (LA) and Florida (FL). Use the data to answer the following questions. You may use the blank cells in the tables for calculations and to show answers Age group 0-15 16-70 71+ Louisiana Deaths 30 215 585 Florida Age group Deaths 0-15 16-70 71+ 25 400 725 Population 165,000 300,000 75,000 Population 90,000 435,000 225,000 a. Calculate the overall crude mortality rates for LA and FL expressed as per 100,000 population. LA: FL: b. Calculate the age-adjusted mortality rates using the combined population as the standard. c. Explain what accounts for this difference in crude rates and adjusted rates between LA and FL.In 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. The population was surveyed again in 2017 and it was up to 250 individuals. What is the growth rate of the coyote population? What will the population size be in 2025?
- It is estimated that approximately 20,000 grizzly bears live in Western Canada, Yukon, and Northwest Territories. Currently, there are 198 grizzly bears remaining in Jasper National Park in an area of 9500 km2. Calculate the density of the grizzly bear population in Jasper Park. Express your answer as a value rounded to two decimal places. Answer grizzly bears/km2There are 453 mice in a population. There is no net immigration or emigration. If 47 mice die and 32 mice are born in one month, what is the population size at the end of the month? What is the size of the population at the end of the month?You want to estimate the population size of pink salmon in the upper pitt river and use a mark-recapture technique to do so. You mark 1313 individuals as they pass under the port mann bridge. two weeks later you recapture 2245 individuals in pitt lake of which 204 have marks on them. What is your estimate of the population size?
- In a graph of population size versus time, a J-shaped curve is characteristic of (a) exponential population growth (b) logistic population growth (c) zero population growth (d) replacement-level fertility (e) population growth momentumWhich of the following situations describes a population at carrying capacity (K)? Group of answer choices Births + immigrants > deaths + emigrants. Births + immigrants = deaths + emigrants. Births + immigrants < deaths + emigrants.It is estimated that approximately 20,000 grizzly bears live in Western Canada, Yukon, and Northwest Territories. Currently, there are 146 grizzly bears remaining in Jasper National Park in an area of 7500 km2. Calculate the density of the grizzly bear population in Jasper Park. Express your answer as a value rounded to two decimal places. Units = grizzly bears/km2