In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid boxes represent the primers and dotted lines represent the newly synthesized DNA strands. A В Template DNA To which direction (towards the left or towards the right) is the replication fork is moving?
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: Draw the structure of alpha-ketoglutarate that is generated in a reaction catalyzed by glutamate…
A: Glutamate dehydrogenase (GDH) catalyzes the conversion of glutamate into α-ketoglutarate. The enzyme…
Q: Some enzymes can be inhibited by high concentrations of their substrates. I expression for the rate…
A: In the biological systems , enzymes acts as catalysts . Enzyme help to accelerate the reactions.…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: Increased levels of NADH in the liver promote the process of gluconeogenesis. What do you make of…
A: Introduction: The process of synthesis of glucose or glycogen from non-carbohydrate sources in the…
Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes
A: The balance between the rate of glucose leaving and entering the blood circulation…
Q: Chemistry A homotetramer (lacking intermolecular covalent interactions) has a native molecular size…
A: Protein structures are organized into four structural levels of organization: primary, secondary,…
Q: 17/18 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Suggest, which enzyme pathway come into play
A: Phenylalanine is an aromatic and non-polar amino acid, it is both glucogenic (Fumarate) and…
Q: 1. DNA replication is described as semi-conservative because A. one leading strand and one lagging…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: The first loss of carbon in the metabolism of glucose takes place as CO2, in the formation of…
A: Glucose metabolism occurs in three stages. They are 1) Glycolysis 2) TCA cycle 3) Oxidative…
Q: Which of the following is true about cell potential? a. It is the sum of the oxidation and reduction…
A: The oxidation-reduction reaction is also called the Redox reaction. This reaction involves…
Q: Match the each enzyme deficiency with their corresponding disease…
A: Different enzymes are required for synthesis of spingolipids. If these enzymes are not…
Q: Can you please help me answer the following question in three paragraphs and in your own words.…
A: Enzymes are substances that enhance the rate of chemical reaction and facilitate the formation of…
Q: CH3 CH3 CH3(CH2)n: O sterol O Cholesterol O Lysophosphatidylcholine O Cholesteryl ester
A: Sterols are important sub groups of steroids that contain OH at 3rd position of A ring of structure.…
Q: 4) Complete hydrogenation of TAG (Y) above would yield a TAG of what fatty acid composition?…
A: In the given table, fatty acid composition of three Tri-acyl Glycerol is given: TAG(X) =…
Q: What is the most stable nitrogenous base pairing?
A: Base can be purines (adenine and guanine) two ring structure and pyrimidines (cytosine and thymine).…
Q: is an amino acid that can be directly converted into a citric acid cycle intermediate by being…
A: Citric acid cycle is the final common oxidative pathway for carbs, proteins and lipid. Amino acids…
Q: Fermentation occurs when is in too scarce amount to continue Its purpose is to re-generate so that…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 3. When the cellular energy charge is high the cells diverts into fatty acid synthesis. A. pyruvate.…
A: Glucose is the primary source of energy for the body. Glucose is metabolized through the glycolytic…
Q: C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correct
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain…
Q: Some of the mammalian Hox genes have been shown tobe more similar to one of the insect Hox genes…
A: The Hox genes are a group of transcription factor genes that have a unique property: they all have…
Q: Explain how Allopurinol works to decrease Uric Acid excretion. (I
A: Allopurinol is a class of medications called xanthine oxidase inhibitors and is used to prevent or…
Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…
A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…
Q: Explain the biochemical consequences of Glucose-6-Phosphatase deficiency that results in gout due to…
A: The enzyme glucose-6-phosphatase regulates the release of glucose from glycogen stored in the liver.…
Q: Given Poly-L-Lysine and Epsilon Poly-L-Lysine, which polymer(s) can easily dissolve in a saline…
A: Poly-L-Lysine are several types of lysine as homopolymers.Poly-Lysine enhances electrostatic…
Q: Choose the wrong, Release of energy (ATP) comes from the Select one: O a. when the terminal…
A: ATP is the energy currency of the cell.
Q: Select the lipid that does not have any fatty acyl groups in its structure: glycerophospholipid,…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но…
A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case…
Q: 1. Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer: 2. Draw the…
A: In a complementary base pairing, purine pairs with a pyrimidine. A always pairs with T, similarly C…
Q: All are factors or subunits contained within the E. coli RNA polymerase holoenzyme in prokaryotic…
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.
A: PCR is polymerase chain reaction used to amplify the DNA . It was first developed by Kary Mullis. It…
Q: Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as…
A: Photothermal therapy is the process of using electro magnetic radiation for treatment of cancer.…
Q: Break down this fatty acid. Show all the products made and the enzymes needed for any non-normal ß…
A: Fatty acids are building blocks of fats and composed of carboxylic acid with long aliphatic chain.…
Q: - RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why…
A: Splicing is a process of removal of non-coding (introns) regions from the gene. Incase of…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: rilling fatty meats over glowing charcoal produces a volatile, pungent chemical which causes…
A: Introduction: A chemical reaction is a process of breaking chemical bonds in one or more substances…
Q: In isoelectric precipitation, the amount of protein precipitate (increases, decreases) below the IpH…
A: Isoelectric point is the pH at which the protein carries no net charge and total charge of protein…
Q: Which of the following statements concerning the enzyme regulation is CORRECT? Select one: A.…
A: Allosteric enzymes have two different binding sites. One is the active site and the other one is the…
Q: 14. Naturally occurring fats are A. L types B. D types C. an equi-molar mixture of L and D types D.…
A: Fat is often used in nutrition, biology, and chemistry to refer to any ester of fatty acids or a…
Q: List the different molecules, an electrons is part of, as it moves from NADPH through the…
A: This is the second phase of photosynthesis , after the light dependent phase. It undertakes CO2…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the…
A: Purines and pyrimidines are nitrogenous bases that makeup two types of nucleotide bases in DNA and…
Q: Glucolate is oxidized into Glvoxylate by cytechrome C using the glycolate oxidase enzyme. The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: what molecules can prevent anabolic steriods form working?
A: Anabolic Steroid are synthetic testosterone hormone used to treat men sex related problem, delayed…
Step by step
Solved in 2 steps with 1 images
- (d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II3. Consider the following diagrams representing three different DNA molecules. (a) 5' 3 3' 5' (b) 5' 3' 5' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these (= molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
- 1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3. Think about what happens at the replication fork. If the gene for helicase is mutated, what part of replication will be affected and how? 4. There are three common types of chemical changes that can damage DNA at any time post-replicatively. In basic terms, name and describe any two of the three types of damage. please help me quickMatch the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicase3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)
- 40.Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA primer first? Why? Why not? A.Yes, because the 5' PO4 is already present in the DNA strand which will be used as a template. B.No, because the RNA primer which contains the free 3' OH in its ribose has to be synthesized by primase first. C.No, because the RNA primer which contains the free 5' PO4 in its ribose will not be synthesized by primase. D.Yes, because the 3' OH is already present in the DNA strand which will be used as a template.Which statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and III
- 1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replicationWhich of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.You are characterizing a new DNA polymerase. In a test tube, you incubate the enzyme with all the components needed for catalysis, EXCEPT you don't add any dNTPs. However, you notice that some type of catalysis has occurred. What is the most likely product in this case? O The supercoils in the DNA have been relieved O The sugar has been converted from a deoxyribose to a ribose A DNA strand is one base shorter due to nuclease activity The magnesium ion has been converted to a charge of +2 to +1