In the regulatory switch experiment, which level of gene expression regulation is the focus? Regulatory switch Enhancer Mouse Enhancer Bat Enhancer Bat-mouse translation level regulation O transcription level regulation O post-translational regulation post-transcriptional regulation (RNA modification)

In the regulatory switch experiment, which level of gene expression regulation is the focus? Regulatory switch Enhancer Mouse Enhancer Bat Enhancer Bat-mouse translation level regulation O transcription level regulation O post-translational regulation post-transcriptional regulation (RNA modification)

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 11RQ: Post-translational control refers to: a. regulation of gene expression after transcription b....

See similar textbooks

Similar questions

Which of the following correctly shows different regulatory mechanisms ranked from fastest to slowest? Answers A -E A. Phosphorylation; Allosteric Regulation; Transcriptional Regulation Allosteric Regulation; Phosphorylation; Transcriptional Regulation C Phosphorylation; Transcriptional Regulation; Allosteric Regulation Transcriptional Regulation; Phosphorylation; Allosteric Regulation Allosteric Regulation, Transcriptional Regulation; Phosphorylation
Which level of gene expression regulation is used in eukaryotes, but not bacteria? transcription level regulation post-translational regulation translation level regulation post-transcriptional regulation (RNA modification)
Which of the following would be used to describe a gene that is transcriptionally controlled by activator ahd/or repressor proteins? Constitutive Regulated Environmental-independent. Permanently repressed. Permanently enhanced. Moving to another question will save this response. 144 Hz ms CURVED Optix MAG271C CAMING Firameless Desgn Gomine Os0 APP msi High Rofresh Rate Fast Respense Time Curved Gaming
Below is a model of a signal transduction pathway that results in the transcribing of mRNA: Receptor protein Transcription factor Phosphorylation cascade DNA mRNA What is the best description of what would happen if the phosphorylation cascade resulted in a phosphate being attached to the transcription factor? O mRN would not stop being transcribed from the DNA. O The phosphorylation cascade would continue to release excess phosphates. O mRNA would stop being translated from the DNA. O Receptor proteins would not bind to the signaling hormone.
Which of the following is NOT true about cis-regulatory elements (CREs)? Group of answer choices Enhancers, silencers and promotors can be located anywhere in relation to the gene Enhancers are involved with increasing gene expression CREs often contain motifs that allow transcription factors to bind CREs are involved in determining the timing, location and amount of gene expression
Given the following schematic for a gene and its associated regulatory regions, answer the following questions by placing the correct letter in the provided blanks please put in the correct letter for the questions What region would provide cell type-specific expression of genes? region What site would significantly increase gene expression rates? = region What region or regions of this gene’s coding sequence are expressed as amino acids = region
What is true about positive control of gene expression? O Under positive control, gene expression does not occur very efficiently unless it is positively influenced Under positive control, gene expression occurs very efficiently unless it is negatively influenced Under positive control, gene expression occurs very efficiently unless it is shut off by the binding of a regulatory molecule
Which of the following is NOT a reason cells regulate gene expression at a level other than the transcriptional level? Some proteins are only required in part of the cell and transcriptional control will only regulate the mRNA/protein throughout the cell. The core promoter for many genes is the same, so these genes will always be transcribed in the same cells. Differential gene expression in different cell types requires regulation of gene expression at levels other than transcription. Transcription and translation are realtively slow processes, so cells need to regulate gene expression post-transcriptionally if they require a fast change in expression of a gene. Not all cells are transcriptionally active (meaning they do not transcribe any genes), so these cells need to regulate gene expression post-transcriptionally.
Describe ways to achieve post-transcriptional control of gene expression
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome
Which of the following would be used to describe a gene that is transcriptionally controlled by activator and/or repressor proteins? Constitutive Regulated Environmental-independent. Permanently repressed. Permanently enhanced.
Gene expression may change in response to external cues through the activity of multiple signal transduction cascades. What is the primary mechanism that determines if a gene is expressed or not?