In transcription, the termination signal is a DNA sequence that tells RNA polymerase toA stop elongation right before the sequence is reachedBDswitch and copy the other strand of DNArecruit a helping cofactorterminate transcription after the signal

Name: In transcription, the termination signal is a DNA sequence that tells
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In transcription, the termination signal is a DNA sequence that tells RNA polymerase toA stop elongation right before the sequence is reachedBDswitch and copy the other strand of DNArecruit a helping cofactorterminate transcription after the signal

DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are nucleic acids and serve as carriers of…

Science

Biology

In transcription, the termination signal is a DNA sequence that tells RNA polymerase to A stop elongation right before the sequence is reached B switch and copy the other strand of DNA recruit a helping cofactor terminate transcription after the signal

In transcription, the termination signal is a DNA sequence that tells RNA polymerase to A stop elongation right before the sequence is reached B switch and copy the other strand of DNA recruit a helping cofactor terminate transcription after the signal

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Energy that drives transcription is provided mainly by _______ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerase
Transcription is a process in which MRNA is synthesized from DNA mRNAis pro duced from only one strand The strand while the other strand, which does not play any strand The statement given ab ove is complete d by the information in DNA strand which trans cribes RNA is called the role in transcription is known as the 11 row. Row 11 A. sense antisense B antisense s ense sense sense antisense antisense
If the sequence of the coding strand in a transcription unit is writtenas follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of mRNA
If the sequence of the coding strand in a transcription unit is written as follows: 5'- ATGCATGCATGCATGOCATGCATGCATGC-3' Write down the sequence of mRNA.
TRANSCRIPTION Transcription is the process in which the information from is converted into a molecule of This happens in the First, is read by an enzyme called RNA polymerase. The RNA polymerase makes a(n) individual strand by adding to the growing strand according to base pairing rules.
Enter the corresponding section of mRNA produced feom the following sections of a DNA template strand: G C G A A T G A C C A T
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for the mRNA transcribed is O ACU O UUU O UGA O UAC OTCA
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base sequence of the mRNA that would result from transcription of this DNA. 5' 3' X
Which of the following is true about transcription? O transcription begins at a start codon and ends at a stop codon codons are composed of four amino acids transcription requires DNA polymerase O both sides of DNA are copied in transcription
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||