Indicate whether each of the following statements about the double-helix secondary structure of DNA is true or false. a. The two polynucleotide strands are complementary rather than identical. b. Bases present extend outward from the double helix. c. Covalent bonding occurs between the two polynucleotide strands. d. The two polynucleotide strands run in the 5′-to-3′ direction

Indicate whether each of the following statements about the double-helix secondary structure of DNA is true or false. a. The two polynucleotide strands are complementary rather than identical. b. Bases present extend outward from the double helix. c. Covalent bonding occurs between the two polynucleotide strands. d. The two polynucleotide strands run in the 5′-to-3′ direction

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

Label each statement about the polynucleotide ATGGCG as true or false. a. The polynucleotide has six nucleotides. b. The polynucleotide contains six phosphodiester linkages. c. The nucleotide at the 5 ' end contains the base guanine. d. The nucleotide at the 3 ' end contains the base guanine. e. The polynucleotide could be part of a DNA molecule. f. The polynucleotide could be part of an RNA molecule.
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
The two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.
Identify the statements that describe the structure of DNA. (select all that are correct) A. A DNA double helix contains two sugar‑phosphate backbones oriented in opposite directions. B. Adenine is paired with thymine, and guanine is paired with cytosine. C. Adenine is paired with cytosine, and guanine is paired with thymine. D. The five‑carbon sugar of DNA is called ribose. E. The five‑carbon sugar of DNA is called deoxyribose.
There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
As we have focused on DNA, the molecule that stores genetic information in all living things. In particular, we discussed its structure and delved into how we analyze this molecule. Based on your knowledge of these topics,answer several fundamental questions: Question: How do we know that in DNA G pairs with C and that Apairs with T as complementary strands are formed?
The underlying structure of DNA is very simple, consisting of only four possible building blocks.a. How is it possible for DNA to carry complexgenetic information if its structure is so simple?b. What are these building blocks? Can each block besubdivided into smaller units, and if so, what arethey? What kinds of chemical bonds link the building blocks?c. How does the underlying structure of RNA differfrom that of DNA?
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
Illustrate the major features of DNA’s primary and secondary structure. Explain the concept of polarity as it applies to the structure of DNA.
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?