ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser Arg Arg Lys Ser Val I Leu Pro Gly Arg Lys Ser Met et Ser Lys Arg Gly Pro Leu Val I Ser Lys Arg Arg Ser Val Met the answer is A, but how do I do it? e if each statement refers to prokaryotic cells, eukaryotic cells or both. ding and lagging strands form during DNA replicationc S complete ribosomal subunit JA replication is coordinated to the cell cycle. rcular DNA

Q: simple words, explain the role of feedback mechanism in maintaining homeostasis

A: Introduction:- The tendency to resist change in order to maintain a stable, relatively consistent in...

Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...

A: Answer : staphylococcus aureus appears golden yellow color because of the carotenoid pigments presen...

Q: Mendel crossed a true-breeding pea plant with green pods and a true-breeding pea plant with yellow p...

A: Gregor Johann Mendel is usually defined as the way that they are been regarded as the father of gene...

Q: How do plants control the opening and the closing of stomata?

A: In this question we have to discuss about how plants control the opening and closing of stomata.  

Q: 1. A 30-year-old sexually active woman presents with a painful vesicle on her external genita- lia a...

A: Introduction :- Lymphadenopathy is the swelling of lymph nodes that can occur as a result of bacteri...

Q: . Which of the following has a genotype with homozygous purple flower and heterozygous tall plant. C...

A: * Homozygous and heterozygous are used to describe the allele pairs. *Individuals that carry two ide...

Q: In Figure 5-5,a. Why do A− and B− cells, by themselves, not formcolonies on the plating medium?b. Wh...

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: a. After conducting the Gram staining procedures and you observed that all cells are stained with to...

A: The microorganisms that can be found in several areas of the habitat and come under the category of ...

Q: What are the typical features of the age yramids of underdeveloped countries?

A: Definition:- The Age Pyramid is a graphical representation of distribution of populations of a parti...

Q: Heterozygous individuals perpetuate some alleles that have lethal effects in homozygous individuals....

A: The term "lethal gene" refers to a gene that causes an individual's death. In nature, these genes mi...

Q: Describe the homeostatic mechanisms that Lacy's body would use to counteract the water deficit S.

A: Homeostasis is the maintenance of the steady-state internal environment of an organism in response t...

Q: Describe how hair cells work in general, and in the fish lateral line system.

A: Lateral line system  It is a type of sensory system found in fishes and aquatic amphibians. This sys...

Q: Select all the characteristics that apply to BACTERIA but not Eukaryotes. □ lack membrane bound-org...

A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than...

Q: Ear Drum Cochlea Oval window (i) Give the biological term for the part labelled 'A' and state its fu...

A: Ear is one of sensory organ and it helps in hearing, postural equilibrium and head-eye movement coor...

Q: A pentapeptide was found to increase the rate of hydrolysis of fats in the adipose tissues to provid...

A: *Electrophoresis is a technique used to separate genetic materials like DNA and RNA and  protein bas...

Q: How would the H+ required to produce ATP differ in an ATP synthase that has an Fo subunit with a c r...

A: H+ produce ATP in this manner ; Low pH increases the concentration of base causing mitochondria to p...

Q: We observed that a hungry herbivorous animal has eaten the bark of a small tree to as far as it can ...

A:   Herbivores are animals whose primary food source is plant-based for example – deer, koalas, and so...

Q: Two adaptations of the monarch butterfly that aid in its survival are the production of a certain ch...

A: Option c- mimicry is correct option . Different animal of different species live their lives in a wa...

Q: It is gram-negative, nutritionally diverse (Photoautotroph, Photoheterotroph, Chemoautotroph, or Che...

A: Proteobacteria include a wide variety of pathogens. The pathogens are  Escherichia, Salmonella, Vibr...

Q: Compared to a 3% agarose gel, how far should the same size DNA travel in a 1% agarose gel? not as fa...

A: The DNA has a uniform mass proportion, DNA particles are isolated by size inside an agarose gel in a...

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: Determine what amino acid will be formed from the given DNA strand below:                          ...

A: Determine what amino acid will be formed from the given DNA strand below:                          3...

Q: Discuss the approaches used to study the effects of toxic chemicals on organisms

A: Introduction  There are certain chemicals that are toxic to mankind like they can cause some adverse...

Q: Cross the two brown frog with both heterozygous alleles on the two genes (BbGg x BbGg).  1. What is...

A:

Q: Associate the biochemical reaction in TSI agar to certain genera or species. Reaction Possible Organ...

A: The triple sugar iron test ( TSI ) in microbiology it is a  test which use for  ability to test micr...

Q: The theory of endosymbiosis explains how or why  ○ free living bacteria became Eukaryotic organelle...

A: Answer : the theory of endosymbiosis explains that :  free living bacteria became Eukaryotic organel...

Q: Which of the following results in green output in spectrophotometry experiment? a. Violet light b....

A: Spectrophotometry: it is used for quantitative analysis of spectra of various wavelengths to compare...

Q: Protostomes- which animals are typical and what do these words mean? 1. Acoelomate 2. Pseudocoemate ...

A: The word "protostome" comes from the Greek words "proto," meaning "first," and "stoma," meaning "mou...

Q: Where on the tree did the amniotic egg evolve? Group of answer choices C A D E B

A: The given tree depicts the evolution of the different chordates as vertebrates, then jawed vertebrat...

Q: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

A: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

Q: What is global warming? |

A: Introduction In this question we will discuss about the global warming in below steps.    

Q: Phases of the Cell Division Cycle What is the correct order of phases in the cell cvcle (start with ...

A: Interphase is made up of three phases: G1 (cell growth), S (DNA synthesis), and G2 (cell division) (...

Q: Malaika is a 30 year old African lady with a history of Schizophrenia. She is currently taking Olanz...

A: Malaika is currently taking Olanzapine 20 mg, a drug to treat Schizophrenia. Olanzapine : Olanzapine...

Q: Which of the following is NOT one of the roles of algae in nature? O a. Petroleum is the fossil rema...

A: Introduction :  Features of algae : Body is relatively simple unicellular or multicellular thallus ...

Q: Question 14 2 pts Select all that describe a mechanism that can lead to the evolution of pathogens. ...

A: Q 14. Bacteria evolve rapidly because they reproduce rapidly. Bifidobacteria mutate to Contaminatio...

Q: During a car accident, Mrs. Tay loses a large amount of blood. How would this affect the process of ...

A: Introduction: Glomerular Filtration Rate or GFR is the rate at which the kidneys form the filtrate i...

Q: True or False. The binding affinity between a peptide agonist and its specific G protein coupled rec...

A: Introduction:- Intermolecular interactions such as ionic bonds, hydrogen bonds, and Van der Waals fo...

Q: 4.)What definite characteristics shows relatedness of birds beak in terms of evolution and extinctio...

A: Finch species have different beak shapes, according to Darwin. He hypothesized that the beak of an e...

Q: Many of the organisms we learned about go through alternation of generations. Which of the following...

A: The organ systems work together to make whole organism. The organism can be haploid or diploid on th...

Q: Why are EMBRYOS so useful when comparing phylogenic relationships?

A: The majority of these similarities occur during embryonic development. Pharyngeal slits, which devel...

Q: if you were to take a nap what would the ideal amount of nap time be, aand why? Would you get more R...

A: A healthy adult's sleep cycle is divided into four distinct phases. The first two phases consist of ...

Q: 2. What is the probability of having odd numbers using two die rolled at one time? A. 1/6 B. 1/3 C. ...

A: ANSWER 2) (D) 1/4 When two dice are thrown simultaneously probability of getting an odd number on bo...

Q: When surface barriers protecting the body are breached, the second line of defense (of the innate im...

A: Inflammation is a normal physiological response of the body to damage caused to tissue. Infection co...

Q: in your own words,  describe the squash soup in terms of appearance, color, size, shape, texture (fi...

A: Squash soup is made from a wide varieties of squash which provides it a appetizing flavor. Along wit...

Q: What is the climax stage of an ecological succession?

A: Introduction:- Ecological succession is the process that describes how the structure of a biological...

Q: Explain why X-linked recessive disorders are more common inmales than in females

A: Sex-linked disorders are inherited or passed from one generation to next on sex chromosomes (either ...

Q: In cats, orange and white stripes (S) are dominant and orange and white spots (s) are recessive, and...

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous chrom...

Q: Why is it important that in an aquatic environment, there are several receptors?

A:

Q: Compare the functions of statocytst, semicircular canals, uticle and saccule

A:

Q: 1. Explain what "optimum" means. Do all enzymes have the same optimum pH and temperature?

A: Optimum means a state at which the best of a reaction or outcome occurs.And it is a level at which t...

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.