Q: In corn, the allele A allows the deposition of anthocyanin (blue) pigment in the kernels (seeds),…
A: Introduction :- Chromosomes are the greatest level of DNA and protein organisation. Chromosomes'…
Q: What is the function of serous fluid?
A: The phrase serous fluid or serosal fluid refers to a variety of benign bodily fluids that resemble…
Q: Which of these statements about the virulence of rabbit myxoma virus is TRUE? A. Rabbit myxoma virus…
A: Myxoma virus It is a DNA pox virus. It is a member of the lepropoxvirus group. It spreads through…
Q: inorganic composition make 60%-70% of bone composition 60%-75% of bone composition O 60%-90% of bone…
A: Bone is basically a calcified tissue and considered as a connective tissue as it contains the ground…
Q: The DNA profile of each individual is highly specific. The chances of two people having exactly the…
A: DNA profiling is a method that helps in identifying and comparing individuals based on their DNA…
Q: How does the body respond to medicine? Check all that apply. Obody is healed from the illness red…
A: Pathogenic microrganism are the organism which have capability to cause disease in any organism.…
Q: to has a flask of whiskey in her bag. She knows from experience that alcohol makes her flushed, it…
A: When the smooth muscle cells in the blood arteries relax, this is known as vasodilation.…
Q: Antibiotics Determined MIC from Test Kank each anti Tron first choice to last choice (based on…
A: The orange shaded zones is considered to be the area where the concerned bacteria is resistant to…
Q: Explain the chemiostic mechanism of ATP generation.
A: Introduction All living organisms synthesize and use adenosine triphosphate (ATP) as the energy…
Q: 5. In Elves, curled toes (T) is dominant to flat toes (t). Dobby, a male Elf that is homozygous…
A: Dominant and Recessive alles An allele is said to be dominant if one copy of the alleles is enough…
Q: Why does a cell use deoxyribonuclease?
A: Introduction: DNA is the basis of the transformation of character from one generation to other…
Q: (f) Parts of a Neuron A C E D H Synapse: The region where an axon terminal communicates with its…
A: Neuron is the fundamental units of brain and nervous system. Neuron consists of dendrites, soma and…
Q: 6.Explain how you should look into a microscope that has two oculars. 7. What two parts of the…
A: 6.Answer----
Q: Match the following (most appropriate combinations): helicase Topoisomerase DNA Polymerase III DNA…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…
Q: 70. Define the term "particles" in the context of air or water. What is the typical size range of…
A: 70. Air particles:- Those particle which are found in air are mixture of various type of solids and…
Q: Xena eventually catches Callisto (remember, she is 25 years old). Salmoneus, who is 60 years old,…
A: Introduction :- Muscles are a type of soft tissue. Your muscles are made up of a lot of elastic…
Q: 2 5 000 11 10 12 13 14 15 16 18 17 8 19 Frog Late Gastrula 20 21
A: Late gastrula At this stage, the endodermal cells present at the periphery to the epithelial…
Q: Callisto has managed to escape Xena, and therefore Xena decides to rest for the night in a small but…
A: In the deep cave at high altitude place near More than 3,500m, leh you must have experienced what…
Q: Neurofibromatosis-1 (NF1) is an autosomal dominant disorder where tumours form in the base layer of…
A: The probability is 1/4
Q: Place a picture of an electron transport chain and mark the following using the appropriate letter:…
A: In the mitochondrial electron transport chain there are four complexes that helps pumping H+ ions…
Q: Give five (5) other examples of samples that are best prepared using Smear Preparation Technique…
A: Smear preparations involve spreading cells from a culture in a thin film over a small region of a…
Q: sustainable fishing solution? Limit the number of fish that can be caught per day. Limit the number…
A: Sustainable fishing need efficient and strategic solution and considering such criteria the option A…
Q: Synthesis of new molecules of deoxyribonucleic acid is the process of A. replication B.…
A: To identify: To identify the name of the process in which synthesis of new molecules of…
Q: Hypertrophy, hyperplasia and increases in extracellular material are forms of A. growth B.…
A: The answer is A Growth Hyperplasia refers to the process where cells in an organ or tissue increase…
Q: Which of the following statements about gene imprinting is correct? (a) Gene imprinting is a male…
A: The basic structural and functional unit of heredity is the gene. They carry genetic information in…
Q: B Sin
A: Chest X-ray The X-ray of the chest involves the use of small comes traditions that are focused on…
Q: After catching her archenemy, Xena has lived a long and productive life. She is now 85 years old and…
A: Introduction The respiratory system is a group of organs and tissues that assist in breathing.…
Q: Which statement best explains why an understanding of life-history trade-offs is important when…
A: Ecology is a branch of biology including human science, population, community, ecosystem, and…
Q: Which of the following consequences of sexual reproduction is considered disadvantageous? A. More…
A: sexual reproduction occurs when sperm from the male parent fertilizes an egg from the female parent,…
Q: Which of the following joints can be considered as never moves type? A) Fibrous joints B) Synostosis…
A: Introduction Joints are formed when different bones connect with others. Most joints allow the…
Q: What are possible Rh genotype/s (using Weiner nomenclature) for SC1 and ID1?
A: There are four possible Rh genotypes that can be determined using Weiner nomenclature: SC1, ID1, Cc,…
Q: Does genetic drift affect natural selection? Yes or No? Discuss and explain it thoroughly
A: Genetic drift is a spontaneous, rapid, by chance cessation of existence of a particular population…
Q: Can you show your calculations on 1gm/.96ft2 = 111.94kg/hectare.
A: For converting gm/ft2 into kg/hectare 1 kg = 1000gm 1 hectare = 107639 ft2 gm/ft2 =…
Q: Conventional signals are not costly because they often entail slight visible variations in only a…
A: D.Female chimps will not mate with a male defeated in combat.
Q: Which of the following patterns is typical of an X-linked recessive trait? males and females are…
A: X linked recessive inheritance refers to a genetic condition that is associated with mutation in…
Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…
A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.
Q: A man feels a shooting pain in his arm, then a thundering in his chest. Realizing that he is in the…
A: Heterologous expression is a process by which a host cell expresses a protein that isn't normally…
Q: When a very strong stimulus initiates an action potential, the response is: I. a longer-duration…
A: Anything that causes an animal or a section of an animal to respond in a way is referred to as a…
Q: What is the most likely mode of inheritance for this trait? I O 1 2 7 2 3 8 9 10 1 DOD 1 2 3 O…
A: Dominant traits never skip a generation because one copy of the gene is enough to exhibit the trait…
Q: Structure (Male) Testicle Epididymis Glans penis Vas deferens Urethra Tunica albuginea Prostate…
A:
Q: Create a table to convey the structural differences between the five immunoglobulin classes. Include…
A: The antibody recognises a pathogen's antigen, which is a fully distinct molecule, and neutralises…
Q: If the G locus were 50 or more map units from the centromere, what types and proportions of gametes…
A: Recombination Recombination is an event in cell division(meiosis and mitosis) in which the exchange…
Q: The endemic plant Dichanthelium lanuginosum requires the presence of the fungus Curvularia…
A: Antagonistic co-evolution: It is basically the relationship between two sexes i.e. male and female…
Q: appropriate way to write an APA format paper?
A: APA format APA format or the American Psychological Association format is a format of official…
Q: (I) Ordinary fish (II) Icefish 3 2 a-Globin gene 3 a-Globin gene fragment (pseudogene) 1 2 3 4 5…
A: Sequence alignment refers to the joining of two sequences based on the similarity of some portions…
Q: Imagine you cross two closely related plant varieties: Maize and teosinte. You hypothesize that…
A: Hybrid Hybrid is a product of two different varieties of same or different species.
Q: A worker received a skin burn as a result of an industrial trauma. On examination: the burned skin…
A: Mechanism of pain due to burn.
Q: The image shows a whole body bone scan using MDP (mono-diphosphonate) labelled with technetium-99m.…
A: The half-life period of a radioactive compound is the time required for half of its components to…
Q: Steps in PCR and Gene Cloning Propose two hypothetically modified or genetically engineered plants…
A: Science is the greatest gift that humanity has received. Nothing could have been more significant in…
Q: genetic drift
A: Genetic drift is the tendency within small interbreeding populations for heterozygous gene pairs to…
Step by step
Solved in 2 steps
- For each of the following scenarios: 1. State the division of the ANS that is represented 2. Draw in the specific neurotransmitter released in the synapse between the pre- and post-ganglionic neurons 3. Draw in the specific neurotransmitter released in the synapse with the target tissue (effector) 4. Draw in the type of receptor on the post-ganglionic neuron 5. Draw in the type of receptor on the target tissue (effector) 6. State the effect this set of neurons has on the target tissue (effector) Example: Sympathetic 0--< Ach o--- ANS Division 0---< 0 0---< 0- 0---< 0---< 0- Nicotinic receptor 0---< 0----< 0----< 0----< NE Alpha-1 receptor Dilator pupillae muscles of iris Target/Effector Heart muscle Heart muscle Smooth muscles of bronchioles Smooth muscles of bronchioles Eccrine sweat glands Apocrine sweat glands Stomach glands that secrete acid Smooth muscle of most blood vessels Dilates pupils Target Effect 0---< 0- 0- 0---< 0- 0---< 0- 0- 0----< 0----< 0----< 0----< 0----< Adipose…What are these cells?%VY lI, نقطة واحدة Q/ finger-like projections that arise from the epithelial layer in some organs are called Cilia Villi Microvilli Non of the above ösly äbäi Q/ The cell of connective tissue that contain serotonin to immediate * hypersensitivity is Histiocyte cell Mast cell Adipose cell Fibroblast cell هذا السؤال مطلوب صفحة 2 من 3 التالي II >
- 1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VCytoplasmic extensions of _______ send and receive chemical messages. a. neuroglial cells b. neurons c. fibroblasts d. melanocytesIn cystic fibrosis protein abnormality occurs, that protein is found in?
- Refer to the codon diagram on. Which of the following is a codon that will terminate translation? * Phe AGU Cys (C) G Trp (W) G UN A C C Arg (R) Leu (L) A Ser (S) Lys (K) A UG Asn (N) His (H) Thr Gin (Q) (T) Arg (R) lle (1) Ctart 是3 MetCan you help me with this label?Each of the following statements concerning the macrophages is true, EXCEPT:* D Sometimes referred to Langerhans cells in the skin Contain numerous primary and secondary lysosomes Have variable shape, because they move in connective tissues O D Manufacture antibodies. O O Phagocytosis of bacteria
- just create mnemonics FOR IT TO EASILY MEMORIZE (NUMBER OF LETTERS REPEATED) N=1, M=2, P=1, E=2, S=4, H=3, A=2, T=2 1. Normocytes 2. Macrocytes3. Microcytes 4. Anisocytosis5. Poikilocytosis 6. Spherocytes7. Elliptocytes 8. Stomatocytes9. Sickle cells 10. Hemoglobin C crystals11. Hemoglobin SC crystals 12. Target cells13. Schistocytes 14. Helmet cells15. Acanthocytes 16. Echinocytes include created andburr cells17. TeardropsThe system which returns interstitial tissue fluid to the bloodstream is ___. the immune system reticuloendothelial system the lymphatic system collateral circulation© stomach images drawing all nam X K Petrona Andres Miguel - Mid ten X 2 Lymphatic System Flows ihq.com/web/viewer.html?state=%7B"ids"%3A%5B"1rw7QicDVdKJanFMKBpulqFTXML9EEc7S"%5D%2C"action"%3A open E Petrona Andres Mig... G stomach images dr. class link = Petrona Andres Mig.. i Dibujos para colore. File:l A 6th Anatomy a. Petrona Andres Miguel - Mid term review A+P (1).pdf 100% Mid Term Anatomy and Physiology Review Lymphatic System + Blood Determine the correct function for the antibodies listed below. a. IgA b. IgD c. Ige d. IgG e. Igm 1. bound to the surface of a B cell 2. crosses the placenta 3. the first antibody released during primary response 4. fixes a compliment 5. a Pentamer 6. the most abundant antibody found in blood plasma and the chief antibody release during secondary responses 7. binds to the surface of mass cells and mediates an allergic response 8. predominant antibody found in mucus saliva and tears Match the following diseases and disorders to the correct…