Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.

Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 3QP: If the genetic code used 4 bases at a time, how many amino acids could be encoded?

See similar textbooks

Similar questions

Describe in detail all of the steps necessary to carry out translation. You may write in complete sentences or provide a numbered or bulleted list. Be sure to indicate the role of each item below: Amino acids, mRNA, 30S ribosome, 50S ribosome, tRNA, protein chain, E site, P site, and A site.
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
For translation, identify two things that happen during each step - initiation, elongation and termination.
The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys
Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are inserted
Choose the answer that has these events of the elongation phase of translation in the proper sequence: 1) A peptide bond forms between the new amino acid and a polypeptide chain. 2) An aminoacyl-tRNA binds to the A site. 3) tRNA leaves the E site. 4) tRNA with an attached polypeptide translocates to the P site. Group of answer choices 4, 3, 2, 1 2, 1, 4, 3 2, 4, 1, 3 2, 1, 3, 4 4, 1, 3, 2
What is the order of the polypeptide chain shown in the images provided? Starting at the beginning of translation, determine the order of the amino acids in the polypeptide chain shown in this figure. Choose correct amino acids from the drop-down menu. (The choices from drop down menu are below). 1. (Choices): Leucine, Valine, Methionine 2. Leucine, Valine, Glycine 3. Valine, Methionine, Leucine 4. Methionine, Leucine, Glycine
An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The template DNA strand will have the following sequence written in the conventional manner with no orientation indicators: The corresponding tRNA sequence written in the conventional manner with no orientation indicators will be: After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, the sequence of the resulting polypeptide is
The following segment of mRNA encodes an interstitial segment of a polypeptide (thedifferent codons appear separately): 5'... AAU CUA UUC AUU AAA ACC ... 3'a) Determine the sequence of the two strands of the DNA fragment from which this RNA comes. highlighting the sense and antisense strandb) What will be the corresponding amino acid sequence that originates in the translation