Answered: Mitochondrial rich cells – what are…

Name: Mitochondrial rich cells – what are they, what they do, costs/benefits
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Mitochondrial rich cells – what are they, what they do, costs/benefits

Science

Biology

Mitochondrial rich cells – what are they, what they do, costs/benefits

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter2: Cells And Cell Division

Section: Chapter Questions

Problem 16QP: Mitosis occurs daily in a human being. What type of cells do humans need to produce in large...

See similar textbooks

Related questions

Q: 13. The following dilutions were performed to determine the concentration of bacteria in a culture.…

Q: An anticodon strand reads 5'-IAG-3'. Fill in the missing base sequences for the possible codons…

A: The anicodon is 5' IAG 3' so the codon for this anticodon would be 5' TGC 3' if the I were to be…

Q: What process might give rise to this population of cells?

A: White blood cells (WBC) are a variety of nucleated cells that circulate for at least a portion of…

Q: b. This cross yields the progeny of the following phenotypes. Write the genotype of each progeny…

A: The shuffling of genes (alleles) between chromosomes is referred to as recombination. This allows…

Q: The Venus flytrap is a carnivorous plant that eats insects. Suppose the county where these are…

A: Loss of habitat is one of the key reasons behind the population declination of many species. This…

Q: 2. Imprinted genes: A) Provide an example of epigenetic inheritance. B) Often are near…

A: Epigenetic regulation of the genome is an absolute critical facet of organism's development. Gene…

Q: to answer the next A diet rich in lycopene, a nutrient found in tomatoes, can reduce the risk of…

Q: the Match the appropriate component of the electrocardiogram with the number on the ECG aka EKG. T S…

A: Electrocardiogram or ECG aka EKG is a tool for evaluating the electrical events during cardiac…

Q: SDS-PAGE is a technique that allows you to do which of the following? Separate proteins based on…

A: Proteins are made up of amino acids that are bounded together by peptide bonds. Different proteins…

Q: ____Synaptic potentiation ____ _________results when a presynaptic cell is stimulated repeatedly

A: Synaptic potentiation, synaptic potentiation results when a presynaptic cell is stimulated…

Q: 38. which of the following pieces id information is NOT found within the discussions of a scientific…

A: Through testing and experimentation, the scientific method establishes facts in an unbiased manner.…

Q: glucagon is synthesized and secreted from the α-cells of the pancreas. Please describe how glucagon…

A: After the meals or in between the meals blood glucose levels tends to fall because of the continued…

Q: At higher altitudes, water boils at a lower temperature True False

A: water boils at 100 degree centigrade at optimum conditions. water freezes at 0 degrees at optimum…

Q: The arm is known as the ________ region; the neck is known as the ________ region. a. otic; axillary…

A: We can say that The human body is complex machinery that is anatomically divided into three…

Q: In biotechnology, gene cloning is a crucial technique used in many genetic modification experiments.…

A: Vectors are the vehicles that carry genes of interest and transmit into another organism . It is…

Q: 16. What is the relationship between an organism's DNA and protein? DNA determines which RNA…

A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33%…

A: Introduction Genetic material is the portion of a cell that contains the genetic information that…

Q: Write the basic information of different types of rats or mice( at least 7 and add their pictures).…

A: 1- House mouse (Mus musculus) Color: black or dusty gray. Weight : 0.75oz Length : 6 to 7 inches.…

Q: Some organisms thrive at pH 2; other organisms thrive at 65°C. Yet mammals cannot tolerate either…

A: Protein structures are produced by the condensing of amino acids into peptide bonds. The arrangement…

Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…

A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…

Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…

A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…

Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…

A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…

Q: To be considered invasive, a species would likely have population growth rates (r) in the introduced…

A: Population growth rate : Population growth rate is the rate of change in the population, in a given…

Q: 5. Which base sequence of a DNA molecule produces a codon on an mRNA molecule that will allow the…

A: A DNA strand can be trancribed to form mRNA molecule which is again translated to produce a sequence…

Q: Describe the stages of meiosis.

A: Introduction Meiosis is a unique form of germ cell division that creates gametes, such as sperm or…

Q: Which of the following polypeptides (written from their N terminal ends) is encoded by the following…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Recommend an international strategy for Drip Footwear to consider

A: Introduction: Drip Footwear is not merely a brand of sneakers. It is a company whose mission is to…

Q: 7. Using the diagram on the left, the molecule coded directly from DNA is represented by what…

A: Instead, the DNA is used to create a messenger RNA (mRNA) molecule, which then controls the…

Q: 2. In fruit flies: At the b locus, + = normal color b = black body At the v locus, + = normal wing v…

A: An individual expressing a dominant trait could have two copies of the dominant allele (homozygous…

Q: Question is related to natural sciences. What is natural science? 2. Discuss the value of studying…

A: Understanding, predicting, and describing natural occurrences are all part of natural science. It…

Q: is energy is released when ATP loses a phosphate group true about ATP and ADP

A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…

Q: If you were sitting quietly in a chair, the time between each of your heart beats would be exactly…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: When two molecules of glucose go through glycolysis, how many molecules of pyruvate are formed? a.…

A: Please follow step 2 for detailed explanation.

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…

A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…

Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…

A: Multiplex PCR used in temperature-mediated DNA polymerase in a thermal cycler. Multiplex PCR is…

Q: Which statement is usually true about phylogenetic trees? a) nodes represent points when traits…

A: Cladogenesis represents divergent evolution or phylogenetic evolution in which parental population…

Q: How do Southern blotting, Northern blotting and Western blotting

A: in genetically modified organism all above three specific separation technique are used for genes…

Q: Write a brief note on ethical usage of animal in pharmacological research? Please answer at your…

A: Animals are used in research to develop medicines and treatment techniques to address illnesses. As…

Q: 4. Which structure protects the plant body against the invasion of parasites?

A: Parasites It refers to an organism that lives on or inside a host organism. It obtains sustenance…

Q: Which of the following processes determines the arrangement of organs and tissues in their…

Q: Fish from Group Number 1 2 3 4 5 6 7 8 9 10 Average: Std Isotocin Injected Control # of acts per 10…

A: Due to little progress was being made in understanding aggression and violence, particularly among…

Q: The sequence shown below is an actual sequence of the toxin gene from Salmonella enterica subspecies…

A: The process of DNA sequencing is used to ascertain the nucleotide sequence of deoxyribonucleic acid.…

Q: Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading…

A: DNA structure formation

Q: The α-ketoglutarate dehydrogenase catalyzes the oxidation of α-ketoglutarate and in this reaction…

A: The oxidation of alpha - ketoglutarate is one of the most important step in the citric acid cycle or…

Q: Describe four different uses for thoracic appendages seen in different crustaceans. Use specific…

A: Crustaceans form a large, diverse arthropod taxon which includes animals such as decapods, seed…

Q: B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…

A: We know that Immunity is resistance to disease. The two important components of immunity are innate…

Q: A B Figure 1 The postgraduate student, Vanessa, cloned her gene of interest into two different…

A: A vector is a living organism that can transmits an infectious agent from an infected animal to…

Q: when 1.6 million year old nariokotome/turkana skeleton was recovered near lake turkana in kenya.…

A: In the year 1984, hominin skeleton is found near the lake Turkana in Kenya.This homin skeleton…

Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Mitochondrial rich cells – what are they, what they do, costs/benefits

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Cytokinesis in Plant Cells
What would happen to a cell if the mitochondria cristae were damaged? should be an original thought, not Google’s few snetences dont use others answers
Eukaryotic cells contain complex structures enclosed within complex membranes called ____________.These complex structures are called ____________that serve to perform the cell’s metabolic activity and ____________ conversion
18:33 A docs.google.com Mitochondria are: Site of cellular respiration Involved in the production of ATP Involved in apoptosis O All of the above are correct The cis face of the Golgi complex is closest to: Plasma membrane Endoplasmic reticulum Ribosomes Lysosome The Golgi complex is the organelle that Synthesize proteins Glycosylates (modifies) glycoproteins Synthesize lipids All of the above
The image below shows a density gradient centrifugation carried out to separate a mixture of lysosomes, peroxisomes and mitochondria Organelle mixture 60L 1.11 Centrifuge 1.15 2 1.19 1.22 1.25 Which fraction would you take to obtain mitichondria, and why? O Fraction 2 because mitochondria contain haemoglobin. giving them a reddish colour O Fraction 3 because it is the most dense fraction O It is impossible to decide without further testing O Fraction 1 because it is the least dense fraction O Fraction 2, because mitochondria contain haem, giving them a reddish colour Increasing density of sucrose (g/cm³) 3.
Cyclin B and_ and degraded by active APC/C. Lare ubiquitylated
Which structure is NOT surrounded by one or more membranes?a. vacuoleb. chloroplastc. peroxisomed. ribosome
Mitochondria and chloroplast have their own DNA and replicate separately from the nucleus and they can synthesize ATP. Can they survive outside of the cell? Explain. Gracias!
Substance found within mitochondrial membrane responsible for intiation of intrinsic pathway of apoptosis
PART D: CALCULATING THE ACTUAL SIZE OF A CELL. Once you know your microscope's diameter of the field of view, you can now calculate the actual size of your specimen. The ACTUAL SIZE of the specimen is the real size of the cell you are looking at. When you look at the cells through the microscope. the cells look very tiny. It is possible to determine the actual size of the cells you are looking at under LP.MP and HP. We will determine the actual size of a cell u I under HP. Step 1- Look at the cells under HP MAG. Step 2- Pick one cell you want to know the size of. Step 3- Imagine that this cell is placed along the left side of the field of view. (see example) Step 4-Estimate how many cels could fit across the field of view. Step 5- Record your answer Step 6- Use the formula below to calculate the actual size of your cell NOTE: Cells are very tiny therefore; the size of a cell is calculated in micrometers (um) and not mm. Cell size in (mm) ACTUAL SIZE OF CELL= HIGH POWERFOV.diameter of…
Stem cells: Where and when are they found, in animals and plants? How are they studied? What are some advantages and potential drawbacks of using them therapeutically?
endoplasmic reticulum in plants and animals